Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PsrA in Stenotrophomonas maltophilia K279a

Properties
Regulator type: Transcription factor
TF locus tag: Smlt2053
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Regulog: PsrA - Xanthomonadales
Statistics of regulated genes:
- Genes 7
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -84
Score: 4.8
Sequence: ATTCAAACAACCGTTTCGCC
Locus tag: Smlt0198
Name: etfD
Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
etfD
Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)

Position: -35
Score: 5.7
Sequence: TATCAAACAATCGTTTGATT
Locus tag: Smlt2053
Name: psrA
Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Locus tag: Smlt2052
Name: fadB
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
Locus tag: Smlt2051
Name: fadA
Funciton: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
psrA
Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
fadB
Enoyl-CoA hydratase (EC 4.2.1.17)
fadA
3-ketoacyl-CoA thiolase (EC 2.3.1.16)

Position: -96
Score: 5.3
Sequence: TTTCAAACGTTCGATTGAAA
Locus tag: Smlt4239
Name: aroQ
Funciton: 3-dehydroquinate dehydratase II (EC 4.2.1.10)
Locus tag: Smlt4240
Name: bccP
Funciton: Biotin carboxyl carrier protein of acetyl-CoA carboxylase
Locus tag: Smlt4241
Name: accC
Funciton: Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14)
aroQ
3-dehydroquinate dehydratase II (EC 4.2.1.10)
bccP
Biotin carboxyl carrier protein of acetyl-CoA carboxylase
accC
Biotin carboxylase of acetyl-CoA carboxylase (EC 6.3.4.14)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD