Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PsrA in Pseudomonas mendocina ymp

Properties
Regulator type: Transcription factor
TF locus tag: Pmen_1588
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Regulog: PsrA - Pseudomonadaceae
Statistics of regulated genes:
- Genes 11
- Operons 8
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 69 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -221
Score: 5.6
Sequence: ATACAAACGTTTGTTTGAAT
Locus tag: Pmen_2707
Name: etfB
Funciton: Electron transfer flavoprotein, beta subunit
Locus tag: Pmen_2706
Name: etfA
Funciton: Electron transfer flavoprotein, alpha subunit
etfB
Electron transfer flavoprotein, beta subunit
etfA
Electron transfer flavoprotein, alpha subunit

Position: -424
Score: 4.8
Sequence: CCTCAAACGGTAGTTTGAAT
Locus tag: Pmen_3020
Name: rpoS
Funciton: RNA polymerase sigma factor RpoS
rpoS
RNA polymerase sigma factor RpoS

Position: -123
Score: 5.9
Sequence: ATTCAAACAAACGTTTGTAT
Locus tag: Pmen_2708
Name: etfD
Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
etfD
Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)

Position: -89
Score: 5.7
Sequence: ATTCAAACAAGCGTATGTTT
Locus tag: Pmen_2531
Name: null
Funciton: Phosphoglycerate mutase family protein
Locus tag: Pmen_2532
Name: scp
Funciton: Sterol-binding domain protein
Phosphoglycerate mutase family protein
scp
Sterol-binding domain protein

Position: -269
Score: 5.2
Sequence: GATTAAACGCTCGTATGAAA
Locus tag: Pmen_0285
Name: algQ
Funciton: Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ
algQ
Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ

Position: -125
Score: 5.9
Sequence: TTTCAAACGCCTGTTTGATT
Locus tag: Pmen_4081
Name: acdH1
Funciton: probable acyl-CoA dehydrogenase
acdH1
probable acyl-CoA dehydrogenase

Position: -178
Score: 5.7
Sequence: AATCAAACGGGCGTATGAAT
Locus tag: Pmen_1580
Name: fadB
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
Locus tag: Pmen_1581
Name: fadA
Funciton: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
fadB
Enoyl-CoA hydratase (EC 4.2.1.17)
fadA
3-ketoacyl-CoA thiolase (EC 2.3.1.16)

Position: -44
Score: 5
Sequence: GCTGAAACGTATGTTTCAAA
Position: -31
Score: 5.8
Sequence: TTTCAAACAAGTGTTTGTCA
Locus tag: Pmen_1588
Name: psrA
Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
psrA
Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD