Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PsrA in Vibrio angustum S14

Properties
Regulator type: Transcription factor
TF locus tag: VAS14_00861
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Regulog: PsrA - Vibrionales
Statistics of regulated genes:
- Genes 9
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 49 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -76
Score: 5.5
Sequence: ATGTAAACAAATGTTTGAAA
Locus tag: VAS14_05978
Name: fadH
Funciton: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
fadH
2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)

Position: -132
Score: 5.4
Sequence: TGTTAAACAAATGTTTAAAT
Locus tag: VAS14_22297
Name: fadB
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
Locus tag: VAS14_22302
Name: fadA
Funciton: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
fadB
Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
fadA
3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)

Position: -114
Score: 5.4
Sequence: ATTTAAACACTTGATTGAAT
Locus tag: VAS14_17336
Name: fadI
Funciton: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
Locus tag: VAS14_17341
Name: fadJ
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
fadI
3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
fadJ
Enoyl-CoA hydratase (EC 4.2.1.17) / Delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)

Position: -33
Score: 5.7
Sequence: ATTTAAACATGTGTTTAATA
Locus tag: VAS14_00861
Name: psrA
Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Locus tag: VAS14_00866
Name: fadE
Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
psrA
Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
fadE
Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)

Position: -215
Score: 5.3
Sequence: TTTCATACAAGTGTTTAAAA
Locus tag: VAS14_14924
Name: fadD
Funciton: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
fadD
Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)

Position: -88
Score: 5.5
Sequence: ATATAAACGCTTGTTTGATT
Locus tag: VAS14_17861
Name: fadD
Funciton: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
fadD
Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD