Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PuuR in Thermotoga lettingae TMO

Properties
Regulator type: Transcription factor
TF locus tag: Tlet_0752
Regulator family: XRE
Regulation mode:
Biological process: Spermidine biosynthesis
Effector: Putrescine
Regulog: PuuR - Thermotogales
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -220
Score: 5.2
Sequence: TTGTTGAGGATAATTGACAA
Position: -62
Score: 5.5
Sequence: GTGATCAATATACTGGACAA
Locus tag: Tlet_0752
Name: puuR
Funciton: Predicted transcriptional regulator of spermidine biosynthesis, Xre family
Locus tag: Tlet_0753
Name: speD
Funciton: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B
Locus tag: Tlet_0754
Name: speE
Funciton: Spermidine synthase (EC 2.5.1.16)
puuR
Predicted transcriptional regulator of spermidine biosynthesis, Xre family
speD
S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B
speE
Spermidine synthase (EC 2.5.1.16)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD