Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PuuR in Thermosipho melanesiensis BI429

Properties
Regulator type: Transcription factor
TF locus tag: Tmel_0572
Regulator family: XRE
Regulation mode:
Biological process: Spermidine biosynthesis
Effector: Putrescine
Regulog: PuuR - Thermotogales
Statistics of regulated genes:
- Genes 7
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -32
Score: 5.5
Sequence: TTGTTTAGTATTATAGACAT
Locus tag: Tmel_0572
Name: puuR
Funciton: Predicted transcriptional regulator of spermidine biosynthesis, Xre family
Locus tag: Tmel_0571
Name: speD
Funciton: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B
Locus tag: Tmel_0570
Name: speE
Funciton: Spermidine synthase (EC 2.5.1.16)
Locus tag: Tmel_0569
Name: potF
Funciton: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2)
Locus tag: Tmel_0568
Name: potA
Funciton: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1)
Locus tag: Tmel_0567
Name: potB
Funciton: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1)
Locus tag: Tmel_0566
Name: potC
Funciton: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1)
puuR
Predicted transcriptional regulator of spermidine biosynthesis, Xre family
speD
S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B
speE
Spermidine synthase (EC 2.5.1.16)
potF
Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2)
potA
Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1)
potB
Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1)
potC
Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD