Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Rex in Lawsonia intracellularis PHE/MN1-00

Properties
Regulator type: Transcription factor
TF locus tag: LI1059
Regulator family: Rex
Regulation mode: repressor
Biological process: Energy metabolism
Effector: NADH
Regulog: Rex - Desulfovibrionales
Statistics of regulated genes:
- Genes 6
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 107 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -171
Score: 4.7
Sequence: TATGTTAAATGAAGCACAAG
Locus tag: LI0399
Name: atpF2
Funciton: ATP synthase F0, B subunit
Locus tag: LI0400
Name: atpH
Funciton: ATP synthase delta chain (EC 3.6.3.14)
Locus tag: LI0401
Name: atpA
Funciton: ATP synthase alpha chain (EC 3.6.3.14)
Locus tag: LI0402
Name: atpG
Funciton: ATP synthase gamma chain (EC 3.6.3.14)
Locus tag: LI0403
Name: atpD
Funciton: ATP synthase beta chain (EC 3.6.3.14)
Locus tag: LI0404
Name: atpC
Funciton: ATP synthase epsilon chain (EC 3.6.3.14)
atpF2
ATP synthase F0, B subunit
atpH
ATP synthase delta chain (EC 3.6.3.14)
atpA
ATP synthase alpha chain (EC 3.6.3.14)
atpG
ATP synthase gamma chain (EC 3.6.3.14)
atpD
ATP synthase beta chain (EC 3.6.3.14)
atpC
ATP synthase epsilon chain (EC 3.6.3.14)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD