Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Rex in Desulfovibrio vulgaris Hildenborough

Properties
Regulator type: Transcription factor
TF locus tag: DVU0916
Regulator family: Rex
Regulation mode: repressor
Biological process: Energy metabolism
Effector: NADH
Regulog: Rex - Desulfovibrionales
Statistics of regulated genes:
- Genes 55
- Operons 14
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 107 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -755
Score: 5.1
Sequence: TTCGTGAAATATTTCACCTT
Locus tag: DVU0694
Name: qrcB
Funciton: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative
Locus tag: DVU0693
Name: qrcC
Funciton: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative
Locus tag: DVU0692
Name: qrcD
Funciton: molybdopterin oxidoreductase, transmembrane subunit, putative
qrcB
molybdopterin oxidoreductase, molybdopterin-binding subunit, putative
qrcC
molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative
qrcD
molybdopterin oxidoreductase, transmembrane subunit, putative

Position: -59
Score: 5
Sequence: TTTGAGCTTTAATTCACAAC
Locus tag: DVU0780
Name: atpF1
Funciton: ATP synthase B' chain (EC 3.6.3.14)
Locus tag: DVU0779
Name: atpF2
Funciton: ATP synthase F0, B subunit
Locus tag: DVU0778
Name: atpH
Funciton: ATP synthase delta chain (EC 3.6.3.14)
Locus tag: DVU0777
Name: atpA
Funciton: ATP synthase alpha chain (EC 3.6.3.14)
Locus tag: DVU0776
Name: atpG
Funciton: ATP synthase gamma chain (EC 3.6.3.14)
Locus tag: DVU0775
Name: atpD
Funciton: ATP synthase beta chain (EC 3.6.3.14)
Locus tag: DVU0774
Name: atpC
Funciton: ATP synthase epsilon chain (EC 3.6.3.14)
atpF1
ATP synthase B' chain (EC 3.6.3.14)
atpF2
ATP synthase F0, B subunit
atpH
ATP synthase delta chain (EC 3.6.3.14)
atpA
ATP synthase alpha chain (EC 3.6.3.14)
atpG
ATP synthase gamma chain (EC 3.6.3.14)
atpD
ATP synthase beta chain (EC 3.6.3.14)
atpC
ATP synthase epsilon chain (EC 3.6.3.14)

Position: -155
Score: 4.5
Sequence: TTTGTCCAAAAAATCACGAG
Locus tag: DVU0402
Name: dsrA
Funciton: Sulfite reductase alpha subunit (EC 1.8.99.1)
Locus tag: DVU0403
Name: dsrB
Funciton: Sulfite reductase beta subunit (EC 1.8.99.1)
Locus tag: DVU0404
Name: dsrD
Funciton: Dissimilatory sulfite reductase D
dsrA
Sulfite reductase alpha subunit (EC 1.8.99.1)
dsrB
Sulfite reductase beta subunit (EC 1.8.99.1)
dsrD
Dissimilatory sulfite reductase D

Position: -79
Score: 5.2
Sequence: ATTGTGCTATTTGGCACAAA
Locus tag: DVU1636
Name: ppaC
Funciton: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
ppaC
Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)

Position: -288
Score: 4.1
Sequence: CGAGCTATATATTTCACAAA
Locus tag: DVU1917
Name: hysB
Funciton: periplasmic [NiFeSe] hydrogenase, small subunit
Locus tag: DVU1918
Name: hysA
Funciton: periplasmic [NiFeSe] hydrogenase, large subunit, selenocysteine-containing
hysB
periplasmic [NiFeSe] hydrogenase, small subunit
hysA
periplasmic [NiFeSe] hydrogenase, large subunit, selenocysteine-containing

Position: -150
Score: 5.7
Sequence: TTTGTAAATTTTTTCACAAG
Locus tag: DVU1295
Name: sat
Funciton: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
sat
Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)

Position: -113
Score: 4.5
Sequence: TTTGGGAAAAAAAGCGCAAG
Locus tag: DVU1795
Name: hupB
Funciton: DNA-binding protein HU-beta (hupB)
hupB
DNA-binding protein HU-beta (hupB)

Position: -54
Score: 4.1
Sequence: CTTGTGGTGTTTTACACAAA
Locus tag: null
Name: null
Funciton: metal dependent phosphohydrolase
Locus tag: DVU2059
Name: null
Funciton: Glycosyl transferase, family 2
metal dependent phosphohydrolase
Glycosyl transferase, family 2

Position: 61
Score: 4.2
Sequence: CTTGTGAACGATTGCACGAA
Locus tag: DVU0920
Name: atpI
Funciton: ATP synthase protein I
Locus tag: DVU0919
Name: atpI2
Funciton: ATP synthase protein I2
Locus tag: DVU0918
Name: atpB
Funciton: ATP synthase A chain (EC 3.6.3.14)
Locus tag: DVU0917
Name: atpE
Funciton: ATP synthase C chain (EC 3.6.3.14)
Locus tag: DVU0916
Name: rex
Funciton: Redox-sensing transcriptional repressor Rex
atpI
ATP synthase protein I
atpI2
ATP synthase protein I2
atpB
ATP synthase A chain (EC 3.6.3.14)
atpE
ATP synthase C chain (EC 3.6.3.14)
rex
Redox-sensing transcriptional repressor Rex

Position: -168
Score: 4.6
Sequence: ATTGTTAATTCCATCACAAG
Locus tag: DVU0846
Name: apsB
Funciton: Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
Locus tag: DVU0847
Name: apsA
Funciton: Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
Locus tag: DVU0848
Name: qmoA
Funciton: quinone-interacting membrane-bound oxidoreductase complex subunit A
Locus tag: DVU0849
Name: qmoB
Funciton: quinone-interacting membrane-bound oxidoreductase complex subunit B
Locus tag: DVU0850
Name: qmoC
Funciton: quinone-interacting membrane-bound oxidoreductase complex subunit C
Locus tag: DVU0851
Name: null
Funciton: hypothetical protein
apsB
Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
apsA
Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
qmoA
quinone-interacting membrane-bound oxidoreductase complex subunit A
qmoB
quinone-interacting membrane-bound oxidoreductase complex subunit B
qmoC
quinone-interacting membrane-bound oxidoreductase complex subunit C
hypothetical protein

Position: -127
Score: 4
Sequence: CTTGTGAAATAATGTTCTTT
Locus tag: DVU2791
Name: dhcA
Funciton: Decaheme cytochrome c associated with Rnf complex
Locus tag: DVU2792
Name: rnfC
Funciton: Electron transport complex protein RnfC
Locus tag: DVU2793
Name: rnfD
Funciton: Electron transport complex protein RnfD
Locus tag: DVU2794
Name: rnfG
Funciton: Electron transport complex protein RnfG
Locus tag: DVU2795
Name: rnfE
Funciton: Electron transport complex protein RnfE
Locus tag: DVU2796
Name: rnfA
Funciton: Electron transport complex protein RnfA
Locus tag: DVU2797
Name: rnfB
Funciton: Electron transport complex protein RnfB
Locus tag: DVU2798
Name: null
Funciton: ApbE family lipoprotein
dhcA
Decaheme cytochrome c associated with Rnf complex
rnfC
Electron transport complex protein RnfC
rnfD
Electron transport complex protein RnfD
rnfG
Electron transport complex protein RnfG
rnfE
Electron transport complex protein RnfE
rnfA
Electron transport complex protein RnfA
rnfB
Electron transport complex protein RnfB
ApbE family lipoprotein

Position: -30
Score: 5
Sequence: CTCGTGAAATTAATGACAAG
Locus tag: DVU1932
Name: adk
Funciton: Adenylate kinase (EC 2.7.4.3)
adk
Adenylate kinase (EC 2.7.4.3)

Position: -116
Score: 4.4
Sequence: ATTGGGAATCGATTCACAAA
Locus tag: DVU2286
Name: cooM
Funciton: Carbon monoxide-induced hydrogenase membrane protein CooM
Locus tag: DVU2287
Name: cooK
Funciton: Carbon monoxide-induced hydrogenase proton translocating subunit CooK @ selenocysteine-containing
Locus tag: DVU2288
Name: cooL
Funciton: Carbon monoxide-induced hydrogenase small subunit CooL
Locus tag: DVU2289
Name: cooX
Funciton: Carbon monoxide-induced hydrogenase iron-sulfur protein CooX
Locus tag: DVU2290
Name: cooU
Funciton: Carbon monoxide-induced hydrogenase NuoC-like protein CooU
Locus tag: DVU2291
Name: cooH
Funciton: Carbon monoxide-induced hydrogenase large subunit CooH
Locus tag: DVU2292
Name: hypA
Funciton: [NiFe] hydrogenase nickel incorporation protein HypA
Locus tag: DVU2293
Name: cooF
Funciton: Carbon monoxide-induced dehydrogenase iron-sulfur protein CooF (EC 1.2.99.2)
cooM
Carbon monoxide-induced hydrogenase membrane protein CooM
cooK
Carbon monoxide-induced hydrogenase proton translocating subunit CooK @ selenocysteine-containing
cooL
Carbon monoxide-induced hydrogenase small subunit CooL
cooX
Carbon monoxide-induced hydrogenase iron-sulfur protein CooX
cooU
Carbon monoxide-induced hydrogenase NuoC-like protein CooU
cooH
Carbon monoxide-induced hydrogenase large subunit CooH
hypA
[NiFe] hydrogenase nickel incorporation protein HypA
cooF
Carbon monoxide-induced dehydrogenase iron-sulfur protein CooF (EC 1.2.99.2)

Position: -40
Score: 4.1
Sequence: TATGTGAAAAAAATCATTTT
Locus tag: DVU1292
Name: null
Funciton: hypothetical protein
Locus tag: DVU1291
Name: null
Funciton: hypothetical protein
Locus tag: DVU1290
Name: dsrM
Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrM (= HmeC)
Locus tag: DVU1289
Name: dsrK
Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrK (=HmeD)
Locus tag: DVU1288
Name: dsrJ
Funciton: Sulfite reduction-associated complex DsrMKJOP multiheme protein DsrJ (=HmeF)
Locus tag: DVU1287
Name: dsrO
Funciton: Sulfite reduction-associated complex DsrMKJOP iron-sulfur protein DsrO (=HmeA)
Locus tag: DVU1286
Name: dsrP
Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrP (= HmeB)
hypothetical protein
hypothetical protein
dsrM
Sulfite reduction-associated complex DsrMKJOP protein DsrM (= HmeC)
dsrK
Sulfite reduction-associated complex DsrMKJOP protein DsrK (=HmeD)
dsrJ
Sulfite reduction-associated complex DsrMKJOP multiheme protein DsrJ (=HmeF)
dsrO
Sulfite reduction-associated complex DsrMKJOP iron-sulfur protein DsrO (=HmeA)
dsrP
Sulfite reduction-associated complex DsrMKJOP protein DsrP (= HmeB)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD