Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Rex in Desulfovibrio salexigens DSM 2638

Properties
Regulator type: Transcription factor
TF locus tag: Desal_3723
Regulator family: Rex
Regulation mode: repressor
Biological process: Energy metabolism
Effector: NADH
Regulog: Rex - Desulfovibrionales
Statistics of regulated genes:
- Genes 37
- Operons 12
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 107 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -74
Score: 4.1
Sequence: CTTGTGAAGGTTTGCGCAAA
Locus tag: Desal_3727
Name: atpI1
Funciton: ATP synthase protein I
Locus tag: Desal_3726
Name: atpI2
Funciton: ATP synthase protein I2
Locus tag: Desal_3725
Name: atpB
Funciton: ATP synthase A chain (EC 3.6.3.14)
Locus tag: Desal_3724
Name: atpE
Funciton: ATP synthase C chain (EC 3.6.3.14)
atpI1
ATP synthase protein I
atpI2
ATP synthase protein I2
atpB
ATP synthase A chain (EC 3.6.3.14)
atpE
ATP synthase C chain (EC 3.6.3.14)

Position: -242
Score: 4.6
Sequence: CTTGACATTTCTTTCACAAA
Locus tag: Desal_0228
Name: sat
Funciton: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
sat
Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)

Position: -112
Score: 4.8
Sequence: TTTGTGAAAAGTTTCATATT
Locus tag: Desal_1042
Name: qrcA
Funciton: cytochrome c class III family protein
Locus tag: Desal_1043
Name: qrcB
Funciton: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative
Locus tag: Desal_1044
Name: qrcC
Funciton: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative
Locus tag: Desal_1045
Name: qrcD
Funciton: molybdopterin oxidoreductase, transmembrane subunit, putative
qrcA
cytochrome c class III family protein
qrcB
molybdopterin oxidoreductase, molybdopterin-binding subunit, putative
qrcC
molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative
qrcD
molybdopterin oxidoreductase, transmembrane subunit, putative

Position: -57
Score: 4.5
Sequence: ATTGTGATAGAAGACACAAG
Locus tag: Desal_2248
Name: ppaC
Funciton: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
ppaC
Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)

Position: -275
Score: 4.7
Sequence: TTTGTGCAAAAATTACCAAA
Position: -144
Score: 4.7
Sequence: TGTGTGAAAATTTTCCCAAT
Locus tag: Desal_2447
Name: null
Funciton: cytochrome c class III
cytochrome c class III

Position: -173
Score: 5
Sequence: CTTGGGAATTAAAGCACAAA
Locus tag: Desal_2181
Name: null
Funciton: Sulfate transporter family protein
Sulfate transporter family protein

Position: 21
Score: 4.7
Sequence: TTCGTGAAAATGTGCACAGG
Locus tag: Desal_2050
Name: hysB
Funciton: periplasmic [NiFeSe] hydrogenase, small subunit
Locus tag: Desal_2049
Name: hysA
Funciton: periplasmic [NiFeSe] hydrogenase, large subunit, selenocysteine-containing
hysB
periplasmic [NiFeSe] hydrogenase, small subunit
hysA
periplasmic [NiFeSe] hydrogenase, large subunit, selenocysteine-containing

Position: -39
Score: 5.1
Sequence: TTTGTGAAATTTGTTACTAA
Locus tag: Desal_1973
Name: adk
Funciton: Adenylate kinase (EC 2.7.4.3)
adk
Adenylate kinase (EC 2.7.4.3)

Position: -146
Score: 4.7
Sequence: CTTGTTCTAAATTTCACTTT
Locus tag: Desal_0229
Name: apsB
Funciton: Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
Locus tag: Desal_0230
Name: apsA
Funciton: Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
Locus tag: Desal_0231
Name: qmoA
Funciton: quinone-interacting membrane-bound oxidoreductase complex subunit A
Locus tag: Desal_0232
Name: qmoB
Funciton: quinone-interacting membrane-bound oxidoreductase complex subunit B
Locus tag: Desal_0233
Name: qmoC
Funciton: quinone-interacting membrane-bound oxidoreductase complex subunit C
Locus tag: Desal_0234
Name: null
Funciton: hypothetical protein
apsB
Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
apsA
Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
qmoA
quinone-interacting membrane-bound oxidoreductase complex subunit A
qmoB
quinone-interacting membrane-bound oxidoreductase complex subunit B
qmoC
quinone-interacting membrane-bound oxidoreductase complex subunit C
hypothetical protein

Position: -177
Score: 4.2
Sequence: GTTGTGTTTTTTTTCACTTA
Locus tag: Desal_0787
Name: dsrA
Funciton: Sulfite reductase alpha subunit (EC 1.8.99.1)
Locus tag: Desal_0788
Name: dsrB
Funciton: Sulfite reductase beta subunit (EC 1.8.99.1)
Locus tag: Desal_0789
Name: dsrD
Funciton: Dissimilatory sulfite reductase D
dsrA
Sulfite reductase alpha subunit (EC 1.8.99.1)
dsrB
Sulfite reductase beta subunit (EC 1.8.99.1)
dsrD
Dissimilatory sulfite reductase D

Position: -150
Score: 4.5
Sequence: TTAGTTAAAAAAATAACAAG
Position: -36
Score: 4.8
Sequence: TTTGGACAAAAATTCACAAC
Locus tag: Desal_3459
Name: atpF1
Funciton: ATP synthase B' chain (EC 3.6.3.14)
Locus tag: Desal_3458
Name: atpF2
Funciton: ATP synthase F0, B subunit
Locus tag: Desal_3457
Name: atpH
Funciton: ATP synthase delta chain (EC 3.6.3.14)
Locus tag: Desal_3456
Name: atpA
Funciton: ATP synthase alpha chain (EC 3.6.3.14)
Locus tag: Desal_3455
Name: atpG
Funciton: ATP synthase gamma chain (EC 3.6.3.14)
Locus tag: Desal_3454
Name: atpD
Funciton: ATP synthase beta chain (EC 3.6.3.14)
Locus tag: Desal_3453
Name: atpC
Funciton: ATP synthase epsilon chain (EC 3.6.3.14)
atpF1
ATP synthase B' chain (EC 3.6.3.14)
atpF2
ATP synthase F0, B subunit
atpH
ATP synthase delta chain (EC 3.6.3.14)
atpA
ATP synthase alpha chain (EC 3.6.3.14)
atpG
ATP synthase gamma chain (EC 3.6.3.14)
atpD
ATP synthase beta chain (EC 3.6.3.14)
atpC
ATP synthase epsilon chain (EC 3.6.3.14)

Position: -118
Score: 3.9
Sequence: AGTGTGACAGAATTCACATT
Locus tag: Desal_0187
Name: null
Funciton: hypothetical protein
Locus tag: Desal_0186
Name: dsrM
Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrM (= HmeC)
Locus tag: Desal_0185
Name: dsrK
Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrK (=HmeD)
Locus tag: Desal_0184
Name: dsrJ
Funciton: Sulfite reduction-associated complex DsrMKJOP multiheme protein DsrJ (=HmeF)
Locus tag: Desal_0183
Name: dsrO
Funciton: Sulfite reduction-associated complex DsrMKJOP iron-sulfur protein DsrO (=HmeA)
Locus tag: Desal_0182
Name: dsrP
Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrP (= HmeB)
hypothetical protein
dsrM
Sulfite reduction-associated complex DsrMKJOP protein DsrM (= HmeC)
dsrK
Sulfite reduction-associated complex DsrMKJOP protein DsrK (=HmeD)
dsrJ
Sulfite reduction-associated complex DsrMKJOP multiheme protein DsrJ (=HmeF)
dsrO
Sulfite reduction-associated complex DsrMKJOP iron-sulfur protein DsrO (=HmeA)
dsrP
Sulfite reduction-associated complex DsrMKJOP protein DsrP (= HmeB)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD