Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Rex in Desulfovibrio magneticus RS-1

Properties
Regulator type: Transcription factor
TF locus tag: DMR_42180
Regulator family: Rex
Regulation mode: repressor
Biological process: Energy metabolism
Effector: NADH
Regulog: Rex - Desulfovibrionales
Statistics of regulated genes:
- Genes 32
- Operons 9
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 107 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -140
Score: 4.2
Sequence: TTTGACACATTTTTCACTTG
Locus tag: DMR_39470
Name: sat
Funciton: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
sat
Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)

Position: -76
Score: 4.4
Sequence: CTTGTGAACTTGTGCACGAG
Locus tag: DMR_42140
Name: atpI1
Funciton: ATP synthase protein I
Locus tag: DMR_42150
Name: atpI2
Funciton: ATP synthase protein I2
Locus tag: DMR_42160
Name: atpB
Funciton: ATP synthase A chain (EC 3.6.3.14)
Locus tag: DMR_42170
Name: atpE
Funciton: ATP synthase C chain (EC 3.6.3.14)
Locus tag: DMR_42180
Name: rex
Funciton: Redox-sensing transcriptional repressor Rex
atpI1
ATP synthase protein I
atpI2
ATP synthase protein I2
atpB
ATP synthase A chain (EC 3.6.3.14)
atpE
ATP synthase C chain (EC 3.6.3.14)
rex
Redox-sensing transcriptional repressor Rex

Position: -217
Score: 5
Sequence: TTCGTGAATTTTTTCATTAG
Locus tag: DMR_18010
Name: qrcA
Funciton: cytochrome c class III family protein
Locus tag: DMR_18020
Name: qrcB
Funciton: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative
Locus tag: DMR_18030
Name: qrcC
Funciton: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative
Locus tag: DMR_18040
Name: qrcD
Funciton: molybdopterin oxidoreductase, transmembrane subunit, putative
qrcA
cytochrome c class III family protein
qrcB
molybdopterin oxidoreductase, molybdopterin-binding subunit, putative
qrcC
molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative
qrcD
molybdopterin oxidoreductase, transmembrane subunit, putative

Position: -32
Score: 4.3
Sequence: ATTGTGAAAAATCAAACATG
Locus tag: DMR_16390
Name: adk
Funciton: Adenylate kinase (EC 2.7.4.3)
adk
Adenylate kinase (EC 2.7.4.3)

Position: -79
Score: 5.3
Sequence: ATTGGGATATTATTCACAAG
Locus tag: DMR_25800
Name: ppaC
Funciton: Manganese-dependent inorganic pyrophosphatase
ppaC
Manganese-dependent inorganic pyrophosphatase

Position: -133
Score: 5.7
Sequence: TTTGTGAAAATAATCACAAA
Locus tag: DMR_02450
Name: hycA
Funciton: NADP-reducing Fe-hydrogenase, subunit A
Locus tag: DMR_02460
Name: hycB
Funciton: NADP-reducing hydrogenase, subunit B
Locus tag: DMR_02470
Name: hycC
Funciton: NADP-reducing Fe-hydrogenase, subunit C
Locus tag: DMR_02480
Name: hycD
Funciton: NADP-reducing Fe-hydrogenase, subunit D
hycA
NADP-reducing Fe-hydrogenase, subunit A
hycB
NADP-reducing hydrogenase, subunit B
hycC
NADP-reducing Fe-hydrogenase, subunit C
hycD
NADP-reducing Fe-hydrogenase, subunit D

Position: -279
Score: 4.4
Sequence: CTTGTTAAACCGATCACAAG
Locus tag: DMR_05390
Name: apsB
Funciton: Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
Locus tag: DMR_05400
Name: apsA
Funciton: Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
Locus tag: DMR_05410
Name: qmoA
Funciton: quinone-interacting membrane-bound oxidoreductase complex subunit A
Locus tag: DMR_05420
Name: qmoB
Funciton: quinone-interacting membrane-bound oxidoreductase complex subunit B
Locus tag: DMR_05430
Name: qmoC
Funciton: quinone-interacting membrane-bound oxidoreductase complex subunit C
Locus tag: DMR_05440
Name: null
Funciton: hypothetical protein
apsB
Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
apsA
Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
qmoA
quinone-interacting membrane-bound oxidoreductase complex subunit A
qmoB
quinone-interacting membrane-bound oxidoreductase complex subunit B
qmoC
quinone-interacting membrane-bound oxidoreductase complex subunit C
hypothetical protein

Position: -166
Score: 4.1
Sequence: ATTGTTCAAAACTTCACGTT
Locus tag: DMR_03600
Name: dsrA
Funciton: Sulfite reductase alpha subunit (EC 1.8.99.1)
Locus tag: DMR_03610
Name: dsrB
Funciton: Sulfite reductase beta subunit (EC 1.8.99.1)
Locus tag: DMR_03620
Name: dsrD
Funciton: Dissimilatory sulfite reductase D
dsrA
Sulfite reductase alpha subunit (EC 1.8.99.1)
dsrB
Sulfite reductase beta subunit (EC 1.8.99.1)
dsrD
Dissimilatory sulfite reductase D

Position: -163
Score: 4.6
Sequence: TTCGGTCAATTCTTCACAAA
Position: -36
Score: 5.1
Sequence: TTTGCAAAAATTTTCACAAC
Locus tag: DMR_04760
Name: atpF1
Funciton: ATP synthase B' chain (EC 3.6.3.14)
Locus tag: DMR_04770
Name: atpF2
Funciton: ATP synthase F0, B subunit
Locus tag: DMR_04780
Name: atpH
Funciton: ATP synthase delta chain (EC 3.6.3.14)
Locus tag: DMR_04790
Name: atpA
Funciton: ATP synthase alpha chain (EC 3.6.3.14)
Locus tag: DMR_04800
Name: atpG
Funciton: ATP synthase gamma chain (EC 3.6.3.14)
Locus tag: DMR_04810
Name: atpD
Funciton: ATP synthase beta chain (EC 3.6.3.14)
Locus tag: DMR_04820
Name: atpC
Funciton: ATP synthase epsilon chain (EC 3.6.3.14)
atpF1
ATP synthase B' chain (EC 3.6.3.14)
atpF2
ATP synthase F0, B subunit
atpH
ATP synthase delta chain (EC 3.6.3.14)
atpA
ATP synthase alpha chain (EC 3.6.3.14)
atpG
ATP synthase gamma chain (EC 3.6.3.14)
atpD
ATP synthase beta chain (EC 3.6.3.14)
atpC
ATP synthase epsilon chain (EC 3.6.3.14)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD