Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Rex in Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Properties
Regulator type: Transcription factor
TF locus tag: Ddes_2257
Regulator family: Rex
Regulation mode: repressor
Biological process: Energy metabolism
Effector: NADH
Regulog: Rex - Desulfovibrionales
Statistics of regulated genes:
- Genes 31
- Operons 8
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 107 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -209
Score: 4
Sequence: ATTTTTAAATATAAAACAAA
Locus tag: Ddes_0921
Name: dsrA
Funciton: Sulfite reductase alpha subunit (EC 1.8.99.1)
Locus tag: Ddes_0920
Name: dsrB
Funciton: Sulfite reductase beta subunit (EC 1.8.99.1)
Locus tag: Ddes_0919
Name: dsrD
Funciton: Dissimilatory sulfite reductase D
dsrA
Sulfite reductase alpha subunit (EC 1.8.99.1)
dsrB
Sulfite reductase beta subunit (EC 1.8.99.1)
dsrD
Dissimilatory sulfite reductase D

Position: -113
Score: 5
Sequence: CTTGCGAAATTTGTCACCAA
Locus tag: Ddes_2183
Name: atpF1
Funciton: ATP synthase B' chain (EC 3.6.3.14)
Locus tag: Ddes_2184
Name: atpF2
Funciton: ATP synthase F0, B subunit
Locus tag: Ddes_2185
Name: atpH
Funciton: ATP synthase delta chain (EC 3.6.3.14)
Locus tag: Ddes_2186
Name: atpA
Funciton: ATP synthase alpha chain (EC 3.6.3.14)
Locus tag: Ddes_2187
Name: atpG
Funciton: ATP synthase gamma chain (EC 3.6.3.14)
Locus tag: Ddes_2188
Name: atpD
Funciton: ATP synthase beta chain (EC 3.6.3.14)
Locus tag: Ddes_2189
Name: atpC
Funciton: ATP synthase epsilon chain (EC 3.6.3.14)
atpF1
ATP synthase B' chain (EC 3.6.3.14)
atpF2
ATP synthase F0, B subunit
atpH
ATP synthase delta chain (EC 3.6.3.14)
atpA
ATP synthase alpha chain (EC 3.6.3.14)
atpG
ATP synthase gamma chain (EC 3.6.3.14)
atpD
ATP synthase beta chain (EC 3.6.3.14)
atpC
ATP synthase epsilon chain (EC 3.6.3.14)

Position: -70
Score: 4.4
Sequence: TTTGTGCTAAAGAGTACAAA
Locus tag: Ddes_0968
Name: ppaC
Funciton: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
ppaC
Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)

Position: -110
Score: 4.3
Sequence: TTTACTATTTTTTTCACGAT
Locus tag: Ddes_1880
Name: cooM
Funciton: Carbon monoxide-induced hydrogenase membrane protein CooM
Locus tag: Ddes_1881
Name: cooK
Funciton: Carbon monoxide-induced hydrogenase proton translocating subunit CooK @ selenocysteine-containing
Locus tag: Ddes_1882
Name: cooL
Funciton: Carbon monoxide-induced hydrogenase small subunit CooL
Locus tag: Ddes_1883
Name: cooX
Funciton: Carbon monoxide-induced hydrogenase iron-sulfur protein CooX
Locus tag: Ddes_1884
Name: cooU
Funciton: Carbon monoxide-induced hydrogenase NuoC-like protein CooU
Locus tag: Ddes_1885
Name: cooH
Funciton: Carbon monoxide-induced hydrogenase large subunit CooH
Locus tag: Ddes_1886
Name: hypA
Funciton: [NiFe] hydrogenase nickel incorporation protein HypA
Locus tag: Ddes_1887
Name: cooF
Funciton: Carbon monoxide-induced dehydrogenase iron-sulfur protein CooF (EC 1.2.99.2)
cooM
Carbon monoxide-induced hydrogenase membrane protein CooM
cooK
Carbon monoxide-induced hydrogenase proton translocating subunit CooK @ selenocysteine-containing
cooL
Carbon monoxide-induced hydrogenase small subunit CooL
cooX
Carbon monoxide-induced hydrogenase iron-sulfur protein CooX
cooU
Carbon monoxide-induced hydrogenase NuoC-like protein CooU
cooH
Carbon monoxide-induced hydrogenase large subunit CooH
hypA
[NiFe] hydrogenase nickel incorporation protein HypA
cooF
Carbon monoxide-induced dehydrogenase iron-sulfur protein CooF (EC 1.2.99.2)

Position: -214
Score: 4.6
Sequence: ACTGTGAAAAATATCACCAA
Locus tag: Ddes_1237
Name: dhcA
Funciton: Decaheme cytochrome c associated with Rnf complex
Locus tag: Ddes_1238
Name: rnfC
Funciton: Electron transport complex protein RnfC
Locus tag: Ddes_1239
Name: rnfD
Funciton: Electron transport complex protein RnfD
Locus tag: Ddes_1240
Name: rnfG
Funciton: Electron transport complex protein RnfG
Locus tag: Ddes_1241
Name: rnfE
Funciton: Electron transport complex protein RnfE
Locus tag: Ddes_1242
Name: rnfA
Funciton: Electron transport complex protein RnfA
Locus tag: Ddes_1243
Name: rnfB
Funciton: Electron transport complex protein RnfB
Locus tag: Ddes_1244
Name: null
Funciton: ApbE family lipoprotein
dhcA
Decaheme cytochrome c associated with Rnf complex
rnfC
Electron transport complex protein RnfC
rnfD
Electron transport complex protein RnfD
rnfG
Electron transport complex protein RnfG
rnfE
Electron transport complex protein RnfE
rnfA
Electron transport complex protein RnfA
rnfB
Electron transport complex protein RnfB
ApbE family lipoprotein

Position: -140
Score: 4.4
Sequence: CTTGTTACTAATTGCGCAAG
Locus tag: Ddes_2130
Name: apsB
Funciton: Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
Locus tag: Ddes_2129
Name: apsA
Funciton: Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
apsB
Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
apsA
Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)

Position: -51
Score: 4.6
Sequence: TGTGTTCTTTTTTGCACAAT
Locus tag: Ddes_1956
Name: adk
Funciton: Adenylate kinase (EC 2.7.4.3)
adk
Adenylate kinase (EC 2.7.4.3)

Position: -108
Score: 5.4
Sequence: TTTGTTAGATTATTCACAAG
Locus tag: Ddes_0454
Name: sat
Funciton: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
sat
Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD