Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Rex in Desulfovibrio desulfuricans G20

Properties
Regulator type: Transcription factor
TF locus tag: Dde_2702
Regulator family: Rex
Regulation mode: repressor
Biological process: Energy metabolism
Effector: NADH
Regulog: Rex - Desulfovibrionales
Statistics of regulated genes:
- Genes 52
- Operons 18
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 107 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -121
Score: 5
Sequence: TTCAGGAAATTTTTCACAAG
Position: -38
Score: 4.9
Sequence: TTTGAGCTTAAATTCACAAC
Locus tag: Dde_0990
Name: atpF1
Funciton: ATP synthase B' chain (EC 3.6.3.14)
Locus tag: Dde_0989
Name: atpF2
Funciton: ATP synthase F0, B subunit
Locus tag: Dde_0988
Name: atpH
Funciton: ATP synthase delta chain (EC 3.6.3.14)
Locus tag: Dde_0987
Name: atpA
Funciton: ATP synthase alpha chain (EC 3.6.3.14)
Locus tag: Dde_0986
Name: atpG
Funciton: ATP synthase gamma chain (EC 3.6.3.14)
Locus tag: Dde_0985
Name: atpD
Funciton: ATP synthase beta chain (EC 3.6.3.14)
Locus tag: Dde_0984
Name: atpC
Funciton: ATP synthase epsilon chain (EC 3.6.3.14)
atpF1
ATP synthase B' chain (EC 3.6.3.14)
atpF2
ATP synthase F0, B subunit
atpH
ATP synthase delta chain (EC 3.6.3.14)
atpA
ATP synthase alpha chain (EC 3.6.3.14)
atpG
ATP synthase gamma chain (EC 3.6.3.14)
atpD
ATP synthase beta chain (EC 3.6.3.14)
atpC
ATP synthase epsilon chain (EC 3.6.3.14)

Position: -153
Score: 4.2
Sequence: TTTGTCCAAAAAATCACGTA
Locus tag: Dde_0526
Name: dsrA
Funciton: Sulfite reductase alpha subunit (EC 1.8.99.1)
Locus tag: Dde_0527
Name: dsrB
Funciton: Sulfite reductase beta subunit (EC 1.8.99.1)
Locus tag: Dde_0528
Name: dsrD
Funciton: Dissimilatory sulfite reductase D
dsrA
Sulfite reductase alpha subunit (EC 1.8.99.1)
dsrB
Sulfite reductase beta subunit (EC 1.8.99.1)
dsrD
Dissimilatory sulfite reductase D

Position: -110
Score: 5
Sequence: TTCGTGAATTTTTTCACCTT
Locus tag: Dde_2932
Name: qrcA
Funciton: cytochrome c class III family protein
Locus tag: Dde_2933
Name: qrcB
Funciton: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative
Locus tag: Dde_2934
Name: qrcC
Funciton: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative
Locus tag: Dde_2935
Name: qrcD
Funciton: molybdopterin oxidoreductase, transmembrane subunit, putative
qrcA
cytochrome c class III family protein
qrcB
molybdopterin oxidoreductase, molybdopterin-binding subunit, putative
qrcC
molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative
qrcD
molybdopterin oxidoreductase, transmembrane subunit, putative

Position: -78
Score: 5.2
Sequence: ATTGTGCTATTTGGCACAAA
Locus tag: Dde_1778
Name: ppaC
Funciton: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
ppaC
Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)

Position: -48
Score: 4.2
Sequence: TTTGTAAAACTGTGCACAGG
Locus tag: Dde_2134
Name: hysB
Funciton: periplasmic [NiFeSe] hydrogenase, small subunit
Locus tag: Dde_2135
Name: hysA
Funciton: periplasmic [NiFeSe] hydrogenase, large subunit, selenocysteine-containing
hysB
periplasmic [NiFeSe] hydrogenase, small subunit
hysA
periplasmic [NiFeSe] hydrogenase, large subunit, selenocysteine-containing

Position: -149
Score: 5.5
Sequence: TTTGCTAAAAATTTCACAAG
Locus tag: Dde_2265
Name: sat
Funciton: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
sat
Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)

Position: -106
Score: 4.8
Sequence: CTTGAGAAAAAAATCTCAAA
Locus tag: Dde_2058
Name: hupB
Funciton: DNA-binding protein HU-beta (hupB)
hupB
DNA-binding protein HU-beta (hupB)

Position: -83
Score: 4.9
Sequence: ATTGTGCATTATTTAACTAG
Locus tag: Dde_1591
Name: null
Funciton: metal dependent phosphohydrolase
Locus tag: Dde_1590
Name: null
Funciton: Glycosyl transferase, family 2
metal dependent phosphohydrolase
Glycosyl transferase, family 2

Position: -107
Score: 4.5
Sequence: CATGTGAAATTTTTCCCGAA
Locus tag: Dde_1140
Name: null
Funciton: MgtC/SapB transporter
MgtC/SapB transporter

Position: -33
Score: 5.3
Sequence: CTTGGGAAATTTTGCACAAC
Locus tag: Dde_0552
Name: null
Funciton: hypothetical protein
hypothetical protein

Position: -188
Score: 5.6
Sequence: TTTGTTAAATATCTCACAAG
Locus tag: Dde_1109
Name: apsB
Funciton: Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
Locus tag: Dde_1110
Name: apsA
Funciton: Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
Locus tag: Dde_1111
Name: qmoA
Funciton: quinone-interacting membrane-bound oxidoreductase complex subunit A
Locus tag: Dde_1112
Name: qmoB
Funciton: quinone-interacting membrane-bound oxidoreductase complex subunit B
Locus tag: Dde_1113
Name: qmoC
Funciton: quinone-interacting membrane-bound oxidoreductase complex subunit C
Locus tag: Dde_1114
Name: null
Funciton: hypothetical protein
apsB
Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
apsA
Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
qmoA
quinone-interacting membrane-bound oxidoreductase complex subunit A
qmoB
quinone-interacting membrane-bound oxidoreductase complex subunit B
qmoC
quinone-interacting membrane-bound oxidoreductase complex subunit C
hypothetical protein

Position: -114
Score: 5.2
Sequence: ATTGTGCTTTTTTGCACAAT
Locus tag: Dde_1076
Name: phsA
Funciton: thiosulfate reductase, putative
Locus tag: Dde_1075
Name: phsB
Funciton: thiosulfate reductase, iron-sulfur binding subunit
phsA
thiosulfate reductase, putative
phsB
thiosulfate reductase, iron-sulfur binding subunit

Position: -226
Score: 4.4
Sequence: TATGTGAAAAATTTAATTAG
Locus tag: Dde_0580
Name: dhcA
Funciton: Decaheme cytochrome c associated with Rnf complex
Locus tag: Dde_0581
Name: rnfC
Funciton: Electron transport complex protein RnfC
Locus tag: Dde_0582
Name: rnfD
Funciton: Electron transport complex protein RnfD
Locus tag: Dde_0583
Name: rnfG
Funciton: Electron transport complex protein RnfG
Locus tag: Dde_0584
Name: rnfE
Funciton: Electron transport complex protein RnfE
Locus tag: Dde_0585
Name: rnfA
Funciton: Electron transport complex protein RnfA
Locus tag: Dde_0586
Name: rnfB
Funciton: Electron transport complex protein RnfB
Locus tag: Dde_0587
Name: null
Funciton: ApbE family lipoprotein
dhcA
Decaheme cytochrome c associated with Rnf complex
rnfC
Electron transport complex protein RnfC
rnfD
Electron transport complex protein RnfD
rnfG
Electron transport complex protein RnfG
rnfE
Electron transport complex protein RnfE
rnfA
Electron transport complex protein RnfA
rnfB
Electron transport complex protein RnfB
ApbE family lipoprotein

Position: -48
Score: 5
Sequence: CTCGTTATTTATTTCACATT
Locus tag: Dde_2702
Name: rex
Funciton: Redox-sensing transcriptional repressor Rex
rex
Redox-sensing transcriptional repressor Rex

Position: -151
Score: 4.8
Sequence: CTTGTGAAAAATTTCTAAAA
Position: -68
Score: 4.1
Sequence: CTTGTGAAGGAATGCACGAA
Locus tag: Dde_2698
Name: atpI1
Funciton: ATP synthase protein I
Locus tag: Dde_2699
Name: atpI2
Funciton: ATP synthase protein I2
Locus tag: Dde_2700
Name: atpB
Funciton: ATP synthase A chain (EC 3.6.3.14)
Locus tag: Dde_2701
Name: atpE
Funciton: ATP synthase C chain (EC 3.6.3.14)
atpI1
ATP synthase protein I
atpI2
ATP synthase protein I2
atpB
ATP synthase A chain (EC 3.6.3.14)
atpE
ATP synthase C chain (EC 3.6.3.14)

Position: -12
Score: 5.1
Sequence: TTCGTGAAATAAATGACAAG
Locus tag: Dde_2028
Name: adk
Funciton: Adenylate kinase (EC 2.7.4.3)
adk
Adenylate kinase (EC 2.7.4.3)

Position: -145
Score: 4.7
Sequence: TACGTTAAAAAAATCACAAT
Locus tag: Dde_2506
Name: null
Funciton: Sulfate transporter family protein
Sulfate transporter family protein

Position: -167
Score: 4
Sequence: TATGTGAAAAAAATAATTAT
Locus tag: Dde_2270
Name: null
Funciton: hypothetical protein
Locus tag: Dde_2271
Name: dsrM
Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrM (= HmeC)
Locus tag: Dde_2272
Name: dsrK
Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrK (=HmeD)
Locus tag: Dde_2273
Name: dsrJ
Funciton: Sulfite reduction-associated complex DsrMKJOP multiheme protein DsrJ (=HmeF)
Locus tag: Dde_2274
Name: dsrO
Funciton: Sulfite reduction-associated complex DsrMKJOP iron-sulfur protein DsrO (=HmeA)
Locus tag: Dde_2275
Name: dsrP
Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrP (= HmeB)
hypothetical protein
dsrM
Sulfite reduction-associated complex DsrMKJOP protein DsrM (= HmeC)
dsrK
Sulfite reduction-associated complex DsrMKJOP protein DsrK (=HmeD)
dsrJ
Sulfite reduction-associated complex DsrMKJOP multiheme protein DsrJ (=HmeF)
dsrO
Sulfite reduction-associated complex DsrMKJOP iron-sulfur protein DsrO (=HmeA)
dsrP
Sulfite reduction-associated complex DsrMKJOP protein DsrP (= HmeB)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD