Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Rex in Desulfohalobium retbaense DSM 5692

Properties
Regulator type: Transcription factor
TF locus tag: Dret_2085
Regulator family: Rex
Regulation mode: repressor
Biological process: Energy metabolism
Effector: NADH
Regulog: Rex - Desulfovibrionales
Statistics of regulated genes:
- Genes 34
- Operons 10
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 107 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -11
Score: 4.6
Sequence: CTTGTGAATGAATGCACGAA
Locus tag: Dret_2089
Name: atpI1
Funciton: ATP synthase protein I
Locus tag: Dret_2088
Name: atpI2
Funciton: ATP synthase protein I2
Locus tag: Dret_2087
Name: atpB
Funciton: ATP synthase A chain (EC 3.6.3.14)
Locus tag: Dret_2086
Name: atpE
Funciton: ATP synthase C chain (EC 3.6.3.14)
atpI1
ATP synthase protein I
atpI2
ATP synthase protein I2
atpB
ATP synthase A chain (EC 3.6.3.14)
atpE
ATP synthase C chain (EC 3.6.3.14)

Position: -19
Score: 4.5
Sequence: ATTGTGAAATTTAGAGCAAA
Locus tag: Dret_2085
Name: rex
Funciton: Redox-sensing transcriptional repressor Rex
rex
Redox-sensing transcriptional repressor Rex

Position: -29
Score: 4.8
Sequence: TTTGTGAAATTTTTCTTCAG
Locus tag: Dret_1683
Name: adk
Funciton: Adenylate kinase (EC 2.7.4.3)
adk
Adenylate kinase (EC 2.7.4.3)

Position: -176
Score: 4.8
Sequence: ATCGTGAAATTTTTCATGAG
Position: -102
Score: 4.7
Sequence: CTCGTGAAATTGTGCACAGG
Locus tag: Dret_0270
Name: qrcA
Funciton: cytochrome c class III family protein
Locus tag: Dret_0271
Name: qrcB
Funciton: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative
Locus tag: Dret_0272
Name: qrcC
Funciton: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative
Locus tag: Dret_0273
Name: qrcD
Funciton: molybdopterin oxidoreductase, transmembrane subunit, putative
qrcA
cytochrome c class III family protein
qrcB
molybdopterin oxidoreductase, molybdopterin-binding subunit, putative
qrcC
molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative
qrcD
molybdopterin oxidoreductase, transmembrane subunit, putative

Position: -273
Score: 4.8
Sequence: CTTGTGCAATAGCGCACAAG
Position: -130
Score: 5.1
Sequence: ATTGATAAAAAAATCACAAA
Locus tag: Dret_1968
Name: sat
Funciton: Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)
sat
Sulfate adenylyltransferase, dissimilatory-type (EC 2.7.7.4)

Position: -84
Score: 5.3
Sequence: TTTGTGCTATTTGGCACAAA
Locus tag: Dret_1594
Name: ppaC
Funciton: Manganese-dependent inorganic pyrophosphatase
ppaC
Manganese-dependent inorganic pyrophosphatase

Position: -167
Score: 4.4
Sequence: CTTGCGCTAAATTTCACTTT
Locus tag: Dret_1967
Name: apsB
Funciton: Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
Locus tag: Dret_1966
Name: apsA
Funciton: Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
Locus tag: Dret_1965
Name: qmoA
Funciton: quinone-interacting membrane-bound oxidoreductase complex subunit A
Locus tag: Dret_1964
Name: qmoB
Funciton: quinone-interacting membrane-bound oxidoreductase complex subunit B
Locus tag: Dret_1963
Name: qmoC
Funciton: quinone-interacting membrane-bound oxidoreductase complex subunit C
Locus tag: Dret_1962
Name: null
Funciton: hypothetical protein
apsB
Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
apsA
Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
qmoA
quinone-interacting membrane-bound oxidoreductase complex subunit A
qmoB
quinone-interacting membrane-bound oxidoreductase complex subunit B
qmoC
quinone-interacting membrane-bound oxidoreductase complex subunit C
hypothetical protein

Position: -109
Score: 4.1
Sequence: GTTGTACGAAAAATCACAAT
Locus tag: Dret_0244
Name: dsrA
Funciton: Sulfite reductase alpha subunit (EC 1.8.99.1)
Locus tag: Dret_0245
Name: dsrB
Funciton: Sulfite reductase beta subunit (EC 1.8.99.1)
Locus tag: Dret_0246
Name: dsrD
Funciton: Dissimilatory sulfite reductase D
dsrA
Sulfite reductase alpha subunit (EC 1.8.99.1)
dsrB
Sulfite reductase beta subunit (EC 1.8.99.1)
dsrD
Dissimilatory sulfite reductase D

Position: -35
Score: 4.3
Sequence: TTTGAACCAAAATTCACATA
Locus tag: Dret_2217
Name: atpF1
Funciton: ATP synthase B' chain (EC 3.6.3.14)
Locus tag: Dret_2216
Name: atpF2
Funciton: ATP synthase F0, B subunit
Locus tag: Dret_2215
Name: atpH
Funciton: ATP synthase delta chain (EC 3.6.3.14)
Locus tag: Dret_2214
Name: atpA
Funciton: ATP synthase alpha chain (EC 3.6.3.14)
Locus tag: Dret_2213
Name: atpG
Funciton: ATP synthase gamma chain (EC 3.6.3.14)
Locus tag: Dret_2212
Name: atpD
Funciton: ATP synthase beta chain (EC 3.6.3.14)
Locus tag: Dret_2211
Name: atpC
Funciton: ATP synthase epsilon chain (EC 3.6.3.14)
atpF1
ATP synthase B' chain (EC 3.6.3.14)
atpF2
ATP synthase F0, B subunit
atpH
ATP synthase delta chain (EC 3.6.3.14)
atpA
ATP synthase alpha chain (EC 3.6.3.14)
atpG
ATP synthase gamma chain (EC 3.6.3.14)
atpD
ATP synthase beta chain (EC 3.6.3.14)
atpC
ATP synthase epsilon chain (EC 3.6.3.14)

Position: -70
Score: 3.8
Sequence: AATGTGAAATTCGGCACACA
Locus tag: Dret_0234
Name: null
Funciton: hypothetical protein
Locus tag: Dret_0235
Name: dsrM
Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrM (= HmeC)
Locus tag: Dret_0236
Name: dsrK
Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrK (=HmeD)
Locus tag: Dret_0237
Name: dsrJ
Funciton: Sulfite reduction-associated complex DsrMKJOP multiheme protein DsrJ (=HmeF)
Locus tag: Dret_0238
Name: dsrO
Funciton: Sulfite reduction-associated complex DsrMKJOP iron-sulfur protein DsrO (=HmeA)
Locus tag: Dret_0239
Name: dsrP
Funciton: Sulfite reduction-associated complex DsrMKJOP protein DsrP (= HmeB)
hypothetical protein
dsrM
Sulfite reduction-associated complex DsrMKJOP protein DsrM (= HmeC)
dsrK
Sulfite reduction-associated complex DsrMKJOP protein DsrK (=HmeD)
dsrJ
Sulfite reduction-associated complex DsrMKJOP multiheme protein DsrJ (=HmeF)
dsrO
Sulfite reduction-associated complex DsrMKJOP iron-sulfur protein DsrO (=HmeA)
dsrP
Sulfite reduction-associated complex DsrMKJOP protein DsrP (= HmeB)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD