Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ModE2 in Desulfovibrio vulgaris str. Miyazaki F

Properties
Regulator type: Transcription factor
TF locus tag: DvMF_0650
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Regulog: ModE2 - Desulfovibrionales
Statistics of regulated genes:
- Genes 10
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 48 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -179
Score: 4.7
Sequence: ATTCTGTCAGGATAGGCATATA
Locus tag: DvMF_2533
Name: null
Funciton: formate dehydrogenase alpha subunit
Locus tag: DvMF_2534
Name: null
Funciton: formate dehydrogenase, beta subunit
formate dehydrogenase alpha subunit
formate dehydrogenase, beta subunit

Position: -331
Score: 5.2
Sequence: ATTATGCTTTTTCAGACATATG
Locus tag: DvMF_0321
Name: null
Funciton: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)

Position: -310
Score: 4.7
Sequence: AATGTGTCACCATTGACATAGT
Position: -258
Score: 4.6
Sequence: CCTATGTCATGCAAGGCATAAA
Locus tag: DvMF_1956
Name: null
Funciton: putative tungsten-containing aldehyde ferredoxin oxidoreductase
putative tungsten-containing aldehyde ferredoxin oxidoreductase

Position: -216
Score: 5.1
Sequence: CATATGTCTGAAAAAGCATAAT
Locus tag: DvMF_0320
Name: phsA
Funciton: molybdopterin oxidoreductase
Locus tag: DvMF_0319
Name: null
Funciton: 4Fe-4S ferredoxin iron-sulfur binding domain protein
phsA
molybdopterin oxidoreductase
4Fe-4S ferredoxin iron-sulfur binding domain protein

Position: -143
Score: 4.3
Sequence: ATTATGTCATTATGAGCAGGTA
Locus tag: DvMF_0650
Name: null
Funciton: Transcriptional regulator, ModE family
Transcriptional regulator, ModE family

Position: -227
Score: 4.5
Sequence: GTTCTGTTTTTTTCAACATGTT
Locus tag: DvMF_2780
Name: null
Funciton: ABC-type tungstate transport system, periplasmic binding protein
Locus tag: DvMF_2781
Name: null
Funciton: ABC-type tungstate transport system, permease protein
Locus tag: DvMF_2782
Name: null
Funciton: ABC-type tungstate transport system, ATP-binding protein
ABC-type tungstate transport system, periplasmic binding protein
ABC-type tungstate transport system, permease protein
ABC-type tungstate transport system, ATP-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD