Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ModE2 in Desulfovibrio vulgaris Hildenborough

Properties
Regulator type: Transcription factor
TF locus tag: DVU1561, DVU1759
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Regulog: ModE2 - Desulfovibrionales
Statistics of regulated genes:
- Genes 10
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 48 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -111
Score: 4.3
Sequence: GTTATGCAAGTCTGTGCATAAG
Locus tag: DVU1560
Name: null
Funciton: molybdopterin binding domain protein
Locus tag: DVU1559
Name: mop
Funciton: aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
molybdopterin binding domain protein
mop
aldehyde oxidase and xanthine dehydrogenase molybdopterin binding

Position: -332
Score: 4.8
Sequence: TCTATGTTTTTTCTGGCATATG
Locus tag: DVU2405
Name: null
Funciton: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)

Position: -170
Score: 4.6
Sequence: TGTGTGTTAATTGTAACATATT
Locus tag: DVU0586
Name: null
Funciton: hypothetical protein
Locus tag: DVU0587
Name: fdnG-1
Funciton: formate dehydrogenase, alpha subunit
Locus tag: DVU0588
Name: hybA
Funciton: formate dehydrogenase, beta subunit
hypothetical protein
fdnG-1
formate dehydrogenase, alpha subunit
hybA
formate dehydrogenase, beta subunit

Position: -333
Score: 4.2
Sequence: TATATGTTTTATTTAACCTACT
Locus tag: DVU2812
Name: fdnG-3
Funciton: formate dehydrogenase, alpha subunit
Locus tag: DVU2811
Name: null
Funciton: Formate dehydrogenase O beta subunit (EC 1.2.1.2)
Locus tag: DVU2810
Name: null
Funciton: formate dehydrogenase formation protein FdhE, putative
Locus tag: DVU2809
Name: null
Funciton: cytochrome c3
fdnG-3
formate dehydrogenase, alpha subunit
Formate dehydrogenase O beta subunit (EC 1.2.1.2)
formate dehydrogenase formation protein FdhE, putative
cytochrome c3
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD