Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ModE2 in Desulfovibrio salexigens DSM 2638

Properties
Regulator type: Transcription factor
TF locus tag: Desal_2331, Desal_2665
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Regulog: ModE2 - Desulfovibrionales
Statistics of regulated genes:
- Genes 17
- Operons 8
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 48 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -336
Score: 5.2
Sequence: ATTATGTCATTTTGGACCTAAT
Position: -114
Score: 5.2
Sequence: ATTATGTCTTTTTTGATATATC
Locus tag: Desal_0300
Name: null
Funciton: molybdopterin binding domain protein
Locus tag: Desal_0299
Name: null
Funciton: aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
molybdopterin binding domain protein
aldehyde oxidase and xanthine dehydrogenase molybdopterin binding

Position: -143
Score: 4.8
Sequence: TCTATGTCAATATGAGCACAAT
Locus tag: Desal_2877
Name: null
Funciton: formate dehydrogenase family accessory protein FdhD
formate dehydrogenase family accessory protein FdhD

Position: -106
Score: 5
Sequence: ATTATGCTCTCCATGACATATG
Locus tag: Desal_2416
Name: wtpA
Funciton: ABC-type tungstate/molybdate transport system, periplasmic component
Locus tag: Desal_2417
Name: wtpB
Funciton: ABC-type tungstate/molybdate transport system, permease protein
Locus tag: Desal_2418
Name: wtpC
Funciton: ABC-type tungstate/molybdate transport system, ATP-binding component
wtpA
ABC-type tungstate/molybdate transport system, periplasmic component
wtpB
ABC-type tungstate/molybdate transport system, permease protein
wtpC
ABC-type tungstate/molybdate transport system, ATP-binding component

Position: -178
Score: 4.9
Sequence: ATTATACCATTTTAGCCATAAT
Position: -78
Score: 4.1
Sequence: CATATGCTTTTTTTAACAGGAA
Locus tag: Desal_2878
Name: null
Funciton: formate dehydrogenase formation protein FdhE
Locus tag: Desal_2879
Name: null
Funciton: Molybdenum cofactor biosynthesis protein MoaA
formate dehydrogenase formation protein FdhE
Molybdenum cofactor biosynthesis protein MoaA

Position: -48
Score: 5.1
Sequence: ATTGTGCCCTATACGGCATAAT
Locus tag: Desal_2666
Name: null
Funciton: Formylmethanofuran dehydrogenase subunit E
Locus tag: Desal_2665
Name: null
Funciton: Transcriptional regulator, ModE family
Formylmethanofuran dehydrogenase subunit E
Transcriptional regulator, ModE family

Position: -169
Score: 5.3
Sequence: AATATGCCAAAAAAGATATAAT
Locus tag: Desal_1641
Name: null
Funciton: Tungsten-containing aldehyde ferredoxin oxidoreductase (EC 1.2.7.-)
Tungsten-containing aldehyde ferredoxin oxidoreductase (EC 1.2.7.-)

Position: -127
Score: 5
Sequence: TATGTGCTAAATCTAACATATT
Locus tag: Desal_2659
Name: null
Funciton: formate dehydrogenase, alpha subunit
Locus tag: Desal_2658
Name: null
Funciton: Formate dehydrogenase O beta subunit (EC 1.2.1.2)
Locus tag: Desal_2657
Name: null
Funciton: formate dehydrogenase formation protein FdhE, putative
formate dehydrogenase, alpha subunit
Formate dehydrogenase O beta subunit (EC 1.2.1.2)
formate dehydrogenase formation protein FdhE, putative

Position: -245
Score: 4.1
Sequence: GATATATTTTAAACAGCATAGG
Position: -136
Score: 4.8
Sequence: ATTGTGCTCATATTGACATAGA
Locus tag: Desal_2876
Name: null
Funciton: ABC-type tungstate transport system, periplasmic binding protein
Locus tag: Desal_2875
Name: null
Funciton: ABC-type tungstate transport system, permease protein
Locus tag: Desal_2874
Name: null
Funciton: ABC-type tungstate transport system, ATP-binding protein
ABC-type tungstate transport system, periplasmic binding protein
ABC-type tungstate transport system, permease protein
ABC-type tungstate transport system, ATP-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD