Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ModE2 in Desulfovibrio magneticus RS-1

Properties
Regulator type: Transcription factor
TF locus tag: DMR_43980
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Regulog: ModE2 - Desulfovibrionales
Statistics of regulated genes:
- Genes 15
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 48 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -327
Score: 4.2
Sequence: ATAATATTTAAAATAACATAGT
Locus tag: DMR_02370
Name: null
Funciton: putative tungsten-containing aldehyde ferredoxin oxidoreductase
putative tungsten-containing aldehyde ferredoxin oxidoreductase

Position: -312
Score: 4.8
Sequence: GTTGTGTCAAAACAGACAGAAG
Locus tag: DMR_17520
Name: nifE
Funciton: Nitrogenase FeMo-cofactor scaffold and assembly protein NifE
Locus tag: DMR_17510
Name: nifN
Funciton: Nitrogenase FeMo-cofactor scaffold and assembly protein NifN
Locus tag: DMR_17500
Name: nifB
Funciton: Nitrogenase FeMo-cofactor synthesis FeS core scaffold and assembly protein NifB
nifE
Nitrogenase FeMo-cofactor scaffold and assembly protein NifE
nifN
Nitrogenase FeMo-cofactor scaffold and assembly protein NifN
nifB
Nitrogenase FeMo-cofactor synthesis FeS core scaffold and assembly protein NifB

Position: -142
Score: 5.4
Sequence: AATGTGTTAATAATAACATAAC
Locus tag: DMR_17150
Name: mop
Funciton: molybdenum-pterin binding protein
mop
molybdenum-pterin binding protein

Position: -113
Score: 4.8
Sequence: CCTATGTTATTTTTAACTTATG
Position: -97
Score: 5.4
Sequence: CTTATGCTAATTTTAGCATAAC
Locus tag: DMR_24460
Name: null
Funciton: formate dehydrogenase, alpha subunit
Locus tag: DMR_24450
Name: null
Funciton: formate dehydrogenase, alpha subunit
Locus tag: DMR_24440
Name: fdhB
Funciton: formate dehydrogenase, beta subunit
formate dehydrogenase, alpha subunit
formate dehydrogenase, alpha subunit
fdhB
formate dehydrogenase, beta subunit

Position: -226
Score: 4.4
Sequence: TTTGTATTTAAAATAACTTAAT
Position: -81
Score: 4.6
Sequence: CGTGTGCCTGATTAGACATAAC
Locus tag: DMR_15760
Name: null
Funciton: formate dehydrogenase alpha subunit
Locus tag: DMR_15750
Name: null
Funciton: formate dehydrogenase, alpha subunit
Locus tag: DMR_15740
Name: null
Funciton: Formate dehydrogenase O beta subunit (EC 1.2.1.2)
Locus tag: DMR_15730
Name: null
Funciton: formate dehydrogenase formation protein FdhE, putative
formate dehydrogenase alpha subunit
formate dehydrogenase, alpha subunit
Formate dehydrogenase O beta subunit (EC 1.2.1.2)
formate dehydrogenase formation protein FdhE, putative

Position: -30
Score: 4.1
Sequence: GTTAAGTTAAATTTGACAGAGG
Locus tag: DMR_12510
Name: null
Funciton: ABC-type tungstate transport system, periplasmic binding protein
Locus tag: DMR_12520
Name: null
Funciton: ABC-type tungstate transport system, permease protein
Locus tag: DMR_12530
Name: null
Funciton: ABC-type tungstate transport system, ATP-binding protein
ABC-type tungstate transport system, periplasmic binding protein
ABC-type tungstate transport system, permease protein
ABC-type tungstate transport system, ATP-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD