Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ModE2 in Desulfovibrio desulfuricans G20

Properties
Regulator type: Transcription factor
TF locus tag: Dde_3511, Dde_3521
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Regulog: ModE2 - Desulfovibrionales
Statistics of regulated genes:
- Genes 19
- Operons 7
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 48 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -66
Score: 4.7
Sequence: AATATGCCTGCACAGGCATATG
Locus tag: Dde_3538
Name: null
Funciton: molybdopterin binding domain protein
Locus tag: Dde_3539
Name: null
Funciton: aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
molybdopterin binding domain protein
aldehyde oxidase and xanthine dehydrogenase molybdopterin binding

Position: -99
Score: 5.1
Sequence: AATATGCTCAACAAGACATAAC
Locus tag: Dde_3511
Name: null
Funciton: Transcriptional regulator, ModE family
Transcriptional regulator, ModE family

Position: -65
Score: 4.4
Sequence: ATTGTGTTTTATTTAGCTGATT
Locus tag: Dde_0234
Name: null
Funciton: ABC-type tungstate transport system, periplasmic binding protein
Locus tag: Dde_0233
Name: cysW
Funciton: ABC-type tungstate transport system, permease protein
Locus tag: Dde_0232
Name: cysA
Funciton: ABC-type tungstate transport system, ATP-binding protein
ABC-type tungstate transport system, periplasmic binding protein
cysW
ABC-type tungstate transport system, permease protein
cysA
ABC-type tungstate transport system, ATP-binding protein

Position: -196
Score: 4.6
Sequence: TTTAGGTTAAAAATAACTTAAT
Locus tag: Dde_2460
Name: aor-4
Funciton: Tungsten-containing aldehyde ferredoxin oxidoreductase (EC 1.2.7.-)
aor-4
Tungsten-containing aldehyde ferredoxin oxidoreductase (EC 1.2.7.-)

Position: -177
Score: 5.4
Sequence: GTTCTGCTATTATTAACATATT
Locus tag: Dde_0715
Name: null
Funciton: hypothetical protein
Locus tag: Dde_0716
Name: null
Funciton: formate dehydrogenase, alpha subunit
Locus tag: Dde_0717
Name: null
Funciton: formate dehydrogenase, alpha subunit
Locus tag: Dde_0718
Name: ,
Funciton: formate dehydrogenase, beta subunit
hypothetical protein
formate dehydrogenase, alpha subunit
formate dehydrogenase, alpha subunit
,
formate dehydrogenase, beta subunit

Position: -133
Score: 5.2
Sequence: GTTGTGTTAATATTAACACATT
Locus tag: Dde_3512
Name: fdnG
Funciton: formate dehydrogenase alpha subunit
Locus tag: Dde_3513
Name: null
Funciton: formate dehydrogenase, alpha subunit
Locus tag: Dde_3514
Name: null
Funciton: Formate dehydrogenase O beta subunit (EC 1.2.1.2)
Locus tag: Dde_3515
Name: null
Funciton: formate dehydrogenase formation protein FdhE, putative
Locus tag: Dde_3516
Name: fdhD
Funciton: Formate dehydrogenase chain D (EC 1.2.1.2)
fdnG
formate dehydrogenase alpha subunit
formate dehydrogenase, alpha subunit
Formate dehydrogenase O beta subunit (EC 1.2.1.2)
formate dehydrogenase formation protein FdhE, putative
fdhD
Formate dehydrogenase chain D (EC 1.2.1.2)

Position: -109
Score: 4.6
Sequence: TTTATGCTTTTTTTAACAAAAA
Locus tag: Dde_0814
Name: null
Funciton: hypothetical protein
Locus tag: Dde_0813
Name: fdnG
Funciton: formate dehydrogenase, alpha subunit
Locus tag: Dde_0812
Name: fdoH
Funciton: formate dehydrogenase, beta subunit
hypothetical protein
fdnG
formate dehydrogenase, alpha subunit
fdoH
formate dehydrogenase, beta subunit
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD