Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ModE2 in Desulfomicrobium baculatum DSM 4028

Properties
Regulator type: Transcription factor
TF locus tag: Dbac_1565, Dbac_0983
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Regulog: ModE2 - Desulfovibrionales
Statistics of regulated genes:
- Genes 12
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 48 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -76
Score: 4.4
Sequence: TTTCTGTCTTTGTTGACTTAAA
Locus tag: Dbac_2354
Name: wtpA
Funciton: ABC-type tungstate/molybdate transport system, periplasmic component
wtpA
ABC-type tungstate/molybdate transport system, periplasmic component

Position: -227
Score: 5
Sequence: ATGATGCCAAACAAGGCATAAT
Locus tag: Dbac_1566
Name: null
Funciton: Formylmethanofuran dehydrogenase subunit E
Locus tag: Dbac_1565
Name: null
Funciton: Transcriptional regulator, ModE family
Formylmethanofuran dehydrogenase subunit E
Transcriptional regulator, ModE family

Position: -120
Score: 4.9
Sequence: GTTATGTCACCCATGACATATG
Locus tag: Dbac_2970
Name: null
Funciton: Tungsten-containing aldehyde ferredoxin oxidoreductase (EC 1.2.7.-)
Tungsten-containing aldehyde ferredoxin oxidoreductase (EC 1.2.7.-)

Position: -125
Score: 4.8
Sequence: TATGTATTATTTATAACATATT
Locus tag: Dbac_1570
Name: null
Funciton: formate dehydrogenase, alpha subunit
Locus tag: Dbac_1569
Name: null
Funciton: Formate dehydrogenase O beta subunit (EC 1.2.1.2)
Locus tag: Dbac_1568
Name: null
Funciton: formate dehydrogenase formation protein FdhE, putative
formate dehydrogenase, alpha subunit
Formate dehydrogenase O beta subunit (EC 1.2.1.2)
formate dehydrogenase formation protein FdhE, putative

Position: -192
Score: 5
Sequence: GTTATGCCTTTCCGGGCATATT
Position: -63
Score: 5.4
Sequence: GATATGTCAATATTGACATGTT
Locus tag: Dbac_1563
Name: null
Funciton: molybdopterin binding domain protein
Locus tag: Dbac_1562
Name: null
Funciton: aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
molybdopterin binding domain protein
aldehyde oxidase and xanthine dehydrogenase molybdopterin binding

Position: -62
Score: 5
Sequence: CTTGTGTCTGATTTGGCATATG
Position: -32
Score: 4.4
Sequence: CGTATGTCATTTTTCACTTAAC
Locus tag: Dbac_3402
Name: null
Funciton: ABC-type tungstate transport system, periplasmic binding protein
Locus tag: Dbac_3403
Name: null
Funciton: ABC-type tungstate transport system, permease protein
Locus tag: Dbac_3404
Name: null
Funciton: ABC-type tungstate transport system, ATP-binding protein
ABC-type tungstate transport system, periplasmic binding protein
ABC-type tungstate transport system, permease protein
ABC-type tungstate transport system, ATP-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD