Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ModE2 in Desulfohalobium retbaense DSM 5692

Properties
Regulator type: Transcription factor
TF locus tag: Dret_2172
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Regulog: ModE2 - Desulfovibrionales
Statistics of regulated genes:
- Genes 8
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 48 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -10
Score: 5
Sequence: GTTATGTTTTATGAGGCATAAC
Locus tag: Dret_0225
Name: null
Funciton: hypothetical protein
Locus tag: Dret_0226
Name: null
Funciton: formate dehydrogenase, alpha subunit
Locus tag: Dret_0227
Name: null
Funciton: formate dehydrogenase, beta subunit
hypothetical protein
formate dehydrogenase, alpha subunit
formate dehydrogenase, beta subunit

Position: -32
Score: 4.4
Sequence: TATATGTCTTTTTTAGCAAAGG
Locus tag: Dret_0525
Name: wtpA
Funciton: ABC-type tungstate/molybdate transport system, periplasmic component
Locus tag: Dret_0526
Name: wtpB
Funciton: ABC-type tungstate/molybdate transport system, permease protein
Locus tag: Dret_0527
Name: wtpC
Funciton: ABC-type tungstate/molybdate transport system, ATP-binding component
wtpA
ABC-type tungstate/molybdate transport system, periplasmic component
wtpB
ABC-type tungstate/molybdate transport system, permease protein
wtpC
ABC-type tungstate/molybdate transport system, ATP-binding component

Position: -166
Score: 4.6
Sequence: GCTATGCAAAAAATCACATAAG
Locus tag: Dret_1807
Name: null
Funciton: molybdopterin binding domain protein
Locus tag: Dret_1808
Name: null
Funciton: aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
molybdopterin binding domain protein
aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD