Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of LexA in Leptothrix cholodnii SP-6

Properties
Regulator type: Transcription factor
TF locus tag: Lcho_2082
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Comamonadaceae
Statistics of regulated genes:
- Genes 7
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 71 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -110
Score: 5.4
Sequence: GACTGGATAAAATTACAGTG
Locus tag: Lcho_2082
Name: lexA
Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
lexA
SOS-response repressor and protease LexA (EC 3.4.21.88)

Position: -56
Score: 4.8
Sequence: CACTGTACAAACATCCAGCA
Locus tag: Lcho_0497
Name: recA
Funciton: Recombinase A
Locus tag: Lcho_0496
Name: recX
Funciton: Regulatory protein RecX
recA
Recombinase A
recX
Regulatory protein RecX

Position: -39
Score: 5.1
Sequence: AACTGTATGCGCATACAGTT
Locus tag: Lcho_2079
Name: PF04055
Funciton: DNA repair photolyase
PF04055
DNA repair photolyase

Position: -32
Score: 5.6
Sequence: GACTGTATGAACATACAGTC
Locus tag: Lcho_2901
Name: imuA
Funciton: Predicted RecA/RadA recombinase
Locus tag: Lcho_2902
Name: imuB
Funciton: DNA polymerase-like protein PA0670
Locus tag: Lcho_2903
Name: null
Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
imuA
Predicted RecA/RadA recombinase
imuB
DNA polymerase-like protein PA0670
DNA polymerase III alpha subunit (EC 2.7.7.7)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD