Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of LexA in Methylibium petroleiphilum PM1

Properties
Regulator type: Transcription factor
TF locus tag: Mpe_A1866
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Comamonadaceae
Statistics of regulated genes:
- Genes 14
- Operons 8
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 71 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -49
Score: 5.4
Sequence: TACTGTATTTACGAACAGTA
Locus tag: Mpe_A0910
Name: Aave_0184
Funciton: Conserved hypothetical protein
Locus tag: Mpe_A0909
Name: null
Funciton: DinG family ATP-dependent helicase CPE1197
Aave_0184
Conserved hypothetical protein
DinG family ATP-dependent helicase CPE1197

Position: -86
Score: 5.8
Sequence: AGCTGGATAAAAATACAGTC
Position: -67
Score: 5.4
Sequence: CACTGGATAAAAATTCAGTG
Locus tag: Mpe_A1866
Name: lexA
Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
lexA
SOS-response repressor and protease LexA (EC 3.4.21.88)

Position: -54
Score: 5.3
Sequence: TACTGTACAAATAACCAGTT
Locus tag: Mpe_A0075
Name: recA
Funciton: Recombinase A
Locus tag: Mpe_A0074
Name: recX
Funciton: Regulatory protein RecX
recA
Recombinase A
recX
Regulatory protein RecX

Position: -133
Score: 5.2
Sequence: TACTGTATGCCCATACAGTC
Locus tag: Mpe_B0617
Name: imuA
Funciton: Predicted RecA/RadA recombinase
Locus tag: Mpe_B0618
Name: imuB
Funciton: DNA polymerase-like protein PA0670
Locus tag: Mpe_B0619
Name: dnaE2
Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
imuA
Predicted RecA/RadA recombinase
imuB
DNA polymerase-like protein PA0670
dnaE2
DNA polymerase III alpha subunit (EC 2.7.7.7)

Position: -6
Score: 5.8
Sequence: TACTGTATGTCCATACAGTA
Locus tag: Mpe_B0052
Name: umuC
Funciton: DNA polymerase V, subunit UmuC
umuC
DNA polymerase V, subunit UmuC

Position: -55
Score: 5.3
Sequence: TACTGTATGGATGTACAGCA
Locus tag: Mpe_B0048
Name: umuD
Funciton: DNA polymerase V, subunit UmuD
umuD
DNA polymerase V, subunit UmuD

Position: -33
Score: 6
Sequence: TACTGTACAAAAATACAGTA
Locus tag: Mpe_A2509
Name: PF04055
Funciton: DNA repair photolyase
PF04055
DNA repair photolyase

Position: -44
Score: 5.7
Sequence: TACTGTATTTATGTACAGTA
Locus tag: Mpe_A1534
Name: imuA
Funciton: Predicted RecA/RadA recombinase
Locus tag: Mpe_A1533
Name: imuB
Funciton: DNA polymerase-like protein PA0670
Locus tag: Mpe_A1532
Name: null
Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
imuA
Predicted RecA/RadA recombinase
imuB
DNA polymerase-like protein PA0670
DNA polymerase III alpha subunit (EC 2.7.7.7)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD