Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of LexA in Verminephrobacter eiseniae EF01-2

Properties
Regulator type: Transcription factor
TF locus tag: Veis_4912
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Comamonadaceae
Statistics of regulated genes:
- Genes 3
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 71 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -75
Score: 5.9
Sequence: AACTGGTTAAAAATACAGCT
Position: -56
Score: 5.5
Sequence: TACTGGATTGAAAAACAGTT
Locus tag: Veis_4912
Name: lexA
Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
lexA
SOS-response repressor and protease LexA (EC 3.4.21.88)

Position: -47
Score: 4.6
Sequence: TACTGTTCAAGCATCCAGCT
Locus tag: Veis_0355
Name: recA
Funciton: Recombinase A
recA
Recombinase A

Position: -52
Score: 5
Sequence: AACTGTTTTTTTATCCAGCT
Locus tag: Veis_1664
Name: parE
Funciton: Topoisomerase IV subunit B (EC 5.99.1.-)
parE
Topoisomerase IV subunit B (EC 5.99.1.-)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD