Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of LexA in Variovorax paradoxus S110

Properties
Regulator type: Transcription factor
TF locus tag: Vapar_2636
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Comamonadaceae
Statistics of regulated genes:
- Genes 12
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 71 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -55
Score: 5.9
Sequence: AACTGGTTAAAAATACAGGT
Position: -36
Score: 4.9
Sequence: TACTGGATATTCAGCCAGTG
Locus tag: Vapar_2636
Name: lexA
Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
lexA
SOS-response repressor and protease LexA (EC 3.4.21.88)

Position: -26
Score: 5
Sequence: TACTGTTGTTTTATACAGCA
Locus tag: Vapar_2806
Name: PF06733
Funciton: DinG family ATP-dependent helicase CPE1197
PF06733
DinG family ATP-dependent helicase CPE1197

Position: -32
Score: 6.4
Sequence: TACTGTATAAAAATACAGTT
Locus tag: Vapar_3206
Name: imuA
Funciton: Predicted RecA/RadA recombinase
Locus tag: Vapar_3205
Name: imuB
Funciton: DNA polymerase-like protein PA0670
Locus tag: Vapar_3204
Name: dnaE2
Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
Locus tag: Vapar_3203
Name: Aave_0184
Funciton: Conserved hypothetical protein
imuA
Predicted RecA/RadA recombinase
imuB
DNA polymerase-like protein PA0670
dnaE2
DNA polymerase III alpha subunit (EC 2.7.7.7)
Aave_0184
Conserved hypothetical protein

Position: -32
Score: 5.5
Sequence: TACTGTTCATCCATACAGTA
Locus tag: Vapar_4538
Name: imuA
Funciton: Predicted RecA/RadA recombinase
Locus tag: Vapar_4537
Name: imuB
Funciton: DNA polymerase-like protein PA0670
Locus tag: Vapar_4536
Name: dnaE2
Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
imuA
Predicted RecA/RadA recombinase
imuB
DNA polymerase-like protein PA0670
dnaE2
DNA polymerase III alpha subunit (EC 2.7.7.7)

Position: -40
Score: 5.9
Sequence: TACTGTGTAAACATACAGTA
Locus tag: Vapar_1693
Name: PF04055
Funciton: DNA repair photolyase
PF04055
DNA repair photolyase

Position: -83
Score: 4.3
Sequence: TACTGTTCAAGCATCCAGCC
Locus tag: Vapar_5195
Name: recA
Funciton: Recombinase A
Locus tag: Vapar_5194
Name: recX
Funciton: Regulatory protein RecX
recA
Recombinase A
recX
Regulatory protein RecX
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD