Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of LexA in Polaromonas sp. JS666

Properties
Regulator type: Transcription factor
TF locus tag: Bpro_2954
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Comamonadaceae
Statistics of regulated genes:
- Genes 13
- Operons 7
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 71 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -115
Score: 6.1
Sequence: AACTGGATGAAAATACAGTT
Position: -96
Score: 5.7
Sequence: TACTGGATATTAAAACAGGT
Locus tag: Bpro_2954
Name: lexA
Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
lexA
SOS-response repressor and protease LexA (EC 3.4.21.88)

Position: -114
Score: 5.3
Sequence: AACTGGGTATTTATCCAGTA
Locus tag: Bpro_3165
Name: parE
Funciton: Topoisomerase IV subunit B (EC 5.99.1.-)
Locus tag: Bpro_3164
Name: yjbJ
Funciton: Conserved hypothetical protein, similar to lytic transglycosylase
Locus tag: Bpro_3163
Name: parC
Funciton: Topoisomerase IV subunit A (EC 5.99.1.-)
parE
Topoisomerase IV subunit B (EC 5.99.1.-)
yjbJ
Conserved hypothetical protein, similar to lytic transglycosylase
parC
Topoisomerase IV subunit A (EC 5.99.1.-)

Position: -10
Score: 5.6
Sequence: TACTGGATGGATGTACAGTA
Locus tag: Bpro_4982
Name: umuD
Funciton: DNA polymerase V, subunit UmuD
Locus tag: Bpro_4983
Name: umuC
Funciton: DNA polymerase V, subunit UmuC
umuD
DNA polymerase V, subunit UmuD
umuC
DNA polymerase V, subunit UmuC

Position: -137
Score: 5.3
Sequence: AACTGGGTATTTATCCAGTA
Locus tag: Bpro_3135
Name: PF04055
Funciton: DNA repair photolyase
PF04055
DNA repair photolyase

Position: -56
Score: 6
Sequence: TACTGTACATAAATACAGTA
Locus tag: Bpro_2386
Name: imuA
Funciton: Predicted RecA/RadA recombinase
Locus tag: Bpro_2387
Name: imuB
Funciton: DNA polymerase-like protein PA0670
Locus tag: Bpro_2388
Name: dnaE2
Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
imuA
Predicted RecA/RadA recombinase
imuB
DNA polymerase-like protein PA0670
dnaE2
DNA polymerase III alpha subunit (EC 2.7.7.7)

Position: -146
Score: 4.2
Sequence: AACTGACTAAAAATAGGGTT
Locus tag: Bpro_4685
Name: recA
Funciton: Recombinase A
Locus tag: Bpro_4684
Name: recX
Funciton: Regulatory protein RecX
recA
Recombinase A
recX
Regulatory protein RecX

Position: -30
Score: 5.7
Sequence: TACTGGTTGTTTGTACAGTA
Locus tag: Bpro_0200
Name: radA
Funciton: DNA repair protein RadA
radA
DNA repair protein RadA
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD