Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of LexA in Polaromonas naphthalenivorans CJ2

Properties
Regulator type: Transcription factor
TF locus tag: Pnap_1918
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Comamonadaceae
Statistics of regulated genes:
- Genes 9
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 71 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -103
Score: 5.5
Sequence: AGCTGTATAAAAATGCAGTT
Position: -84
Score: 5.9
Sequence: TACTGGATATTCATACAGTC
Locus tag: Pnap_1918
Name: lexA
Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
lexA
SOS-response repressor and protease LexA (EC 3.4.21.88)

Position: -64
Score: 5.4
Sequence: AACTGTATGTTTGTACAGGT
Locus tag: Pnap_1199
Name: parE
Funciton: Topoisomerase IV subunit B (EC 5.99.1.-)
Locus tag: Pnap_1200
Name: yjbJ
Funciton: Conserved hypothetical protein, similar to lytic transglycosylase
Locus tag: Pnap_1201
Name: parC
Funciton: Topoisomerase IV subunit A (EC 5.99.1.-)
parE
Topoisomerase IV subunit B (EC 5.99.1.-)
yjbJ
Conserved hypothetical protein, similar to lytic transglycosylase
parC
Topoisomerase IV subunit A (EC 5.99.1.-)

Position: -33
Score: 6
Sequence: TACTGGTTATTCATACAGTA
Locus tag: Pnap_4894
Name: imuA
Funciton: Predicted RecA/RadA recombinase
Locus tag: Pnap_4895
Name: imuB
Funciton: DNA polymerase-like protein PA0670
Locus tag: Pnap_4896
Name: dnaE2
Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
imuA
Predicted RecA/RadA recombinase
imuB
DNA polymerase-like protein PA0670
dnaE2
DNA polymerase III alpha subunit (EC 2.7.7.7)

Position: -102
Score: 4.4
Sequence: TACTGTTCATGCACCCAGTA
Locus tag: Pnap_3956
Name: recA
Funciton: Recombinase A
Locus tag: Pnap_3955
Name: recX
Funciton: Regulatory protein RecX
recA
Recombinase A
recX
Regulatory protein RecX
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD