Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of LexA in Delftia acidovorans SPH-1

Properties
Regulator type: Transcription factor
TF locus tag: Daci_3565
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Comamonadaceae
Statistics of regulated genes:
- Genes 9
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 71 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -83
Score: 5.8
Sequence: AACTGGTTAAAAATACAGAT
Position: -64
Score: 4.7
Sequence: TACTGTATAAATCATCAGAT
Locus tag: Daci_3565
Name: lexA
Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
lexA
SOS-response repressor and protease LexA (EC 3.4.21.88)

Position: -35
Score: 5.8
Sequence: TGCTGTATATTCATACAGTA
Locus tag: Daci_4263
Name: imuA
Funciton: Predicted RecA/RadA recombinase
Locus tag: Daci_4262
Name: imuB
Funciton: DNA polymerase-like protein PA0670
Locus tag: Daci_4261
Name: dnaE2
Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
imuA
Predicted RecA/RadA recombinase
imuB
DNA polymerase-like protein PA0670
dnaE2
DNA polymerase III alpha subunit (EC 2.7.7.7)

Position: -54
Score: 5.6
Sequence: GACTGTATAAAGATACAGTT
Locus tag: Daci_5814
Name: PF08774
Funciton: Hypothetical protein, restriction endonuclease-like VRR-NUC domain
Locus tag: Daci_5813
Name: PF06733
Funciton: DinG family ATP-dependent helicase CPE1197
PF08774
Hypothetical protein, restriction endonuclease-like VRR-NUC domain
PF06733
DinG family ATP-dependent helicase CPE1197

Position: 2
Score: 5.6
Sequence: GACTGTATTTTTATACAGTT
Locus tag: Daci_2403
Name: PF04055
Funciton: DNA repair photolyase
PF04055
DNA repair photolyase

Position: -66
Score: 4.3
Sequence: TACTGTTCAAGCATCCAGCC
Locus tag: Daci_0874
Name: recA
Funciton: Recombinase A
Locus tag: Daci_0873
Name: recX
Funciton: Regulatory protein RecX
recA
Recombinase A
recX
Regulatory protein RecX
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD