Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of LexA in Acidovorax avenae subsp. citrulli AAC00-1

Properties
Regulator type: Transcription factor
TF locus tag: Aave_2558
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Comamonadaceae
Statistics of regulated genes:
- Genes 18
- Operons 8
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 71 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -33
Score: 4.8
Sequence: CACTGTATTTACAATCAGTG
Locus tag: Aave_0184
Name: Aave_0184
Funciton: Conserved hypothetical protein
Locus tag: Aave_0185
Name: PF06733
Funciton: DinG family ATP-dependent helicase CPE1197
Aave_0184
Conserved hypothetical protein
PF06733
DinG family ATP-dependent helicase CPE1197

Position: -95
Score: 6.1
Sequence: AACTGTTTAAAAATACAGTG
Locus tag: Aave_2558
Name: lexA
Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
lexA
SOS-response repressor and protease LexA (EC 3.4.21.88)

Position: -34
Score: 5.4
Sequence: TGCTGTATATTTGAACAGTA
Locus tag: Aave_2670
Name: imuA
Funciton: Predicted RecA/RadA recombinase
Locus tag: Aave_2671
Name: imuB
Funciton: DNA polymerase-like protein PA0670
Locus tag: Aave_2672
Name: dnaE2
Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
imuA
Predicted RecA/RadA recombinase
imuB
DNA polymerase-like protein PA0670
dnaE2
DNA polymerase III alpha subunit (EC 2.7.7.7)

Position: -98
Score: 4.3
Sequence: TACTGGTCAAGCATCCAGCC
Locus tag: Aave_4640
Name: recA
Funciton: Recombinase A
Locus tag: Aave_4641
Name: recX
Funciton: Regulatory protein RecX
recA
Recombinase A
recX
Regulatory protein RecX

Position: -52
Score: 4.1
Sequence: GGCTGTCTTTCCATCCAGTA
Locus tag: Aave_1340
Name: parE
Funciton: Topoisomerase IV subunit B (EC 5.99.1.-)
Locus tag: Aave_1341
Name: yjbJ
Funciton: Conserved hypothetical protein, similar to lytic transglycosylase
Locus tag: Aave_1342
Name: parC
Funciton: Topoisomerase IV subunit A (EC 5.99.1.-)
parE
Topoisomerase IV subunit B (EC 5.99.1.-)
yjbJ
Conserved hypothetical protein, similar to lytic transglycosylase
parC
Topoisomerase IV subunit A (EC 5.99.1.-)

Position: -49
Score: 5.9
Sequence: TACTGTTTATTCATACAGTG
Locus tag: Aave_0516
Name: imuA
Funciton: Predicted RecA/RadA recombinase
Locus tag: Aave_0517
Name: imuB
Funciton: DNA polymerase-like protein PA0670
Locus tag: Aave_0518
Name: dnaE2
Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
imuA
Predicted RecA/RadA recombinase
imuB
DNA polymerase-like protein PA0670
dnaE2
DNA polymerase III alpha subunit (EC 2.7.7.7)

Position: -43
Score: 5.7
Sequence: TACTGTATAAATAATCAGTA
Locus tag: Aave_2734
Name: imuA
Funciton: Predicted RecA/RadA recombinase
Locus tag: Aave_2733
Name: imuB
Funciton: DNA polymerase-like protein PA0670
Locus tag: Aave_2732
Name: dnaE2
Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
imuA
Predicted RecA/RadA recombinase
imuB
DNA polymerase-like protein PA0670
dnaE2
DNA polymerase III alpha subunit (EC 2.7.7.7)

Position: -42
Score: 6.1
Sequence: AACTGTATATTCATACAGTT
Locus tag: Aave_2176
Name: PF04055
Funciton: DNA repair photolyase
PF04055
DNA repair photolyase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD