Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of LexA in Aeromonas salmonicida subsp. salmonicida A449

Properties
Regulator type: Transcription factor
TF locus tag: ASA_4206
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes 12
- Operons 10
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 77 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -69
Score: 5.9
Sequence: TACTGTATGAATAGACAGTA
Locus tag: ASA_3809
Name: recA
Funciton: Recombinase A
Locus tag: ASA_3810
Name: recX
Funciton: Regulatory protein RecX
recA
Recombinase A
recX
Regulatory protein RecX

Position: -35
Score: 4.3
Sequence: ATTTGGACATATTTACAGTG
Locus tag: ASA_4113
Name: recG
Funciton: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
recG
ATP-dependent DNA helicase RecG (EC 3.6.1.-)

Position: -36
Score: 5.5
Sequence: TACTGTTCGCATATACAGTA
Locus tag: ASA_0267
Name: topB
Funciton: DNA topoisomerase III (EC 5.99.1.2)
topB
DNA topoisomerase III (EC 5.99.1.2)

Position: -73
Score: 4.8
Sequence: CACTGTATGAACGTACAATA
Locus tag: ASA_2190
Name: polB
Funciton: DNA polymerase II (EC 2.7.7.7)
polB
DNA polymerase II (EC 2.7.7.7)

Position: -74
Score: 5.1
Sequence: TGCTGGATACTTATCCAGTT
Locus tag: ASA_0735
Name: ruvA
Funciton: Holliday junction DNA helicase RuvA
Locus tag: ASA_0736
Name: ruvB
Funciton: Holliday junction DNA helicase RuvB
ruvA
Holliday junction DNA helicase RuvA
ruvB
Holliday junction DNA helicase RuvB

Position: -67
Score: 5.6
Sequence: TACTGTATGGAAAACCAGTA
Position: -45
Score: 5.5
Sequence: TACTGGATGCATACACAGTA
Locus tag: ASA_2999
Name: recN
Funciton: DNA repair protein RecN
recN
DNA repair protein RecN

Position: -49
Score: 5.3
Sequence: CACTGTATATACTGCCAGTG
Position: -29
Score: 5.5
Sequence: TGCTGTATAAAAAAACAGGT
Locus tag: ASA_4206
Name: lexA
Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
lexA
SOS-response repressor and protease LexA (EC 3.4.21.88)

Position: -72
Score: 5.2
Sequence: ACCTGTCTATTCATCCAGTA
Locus tag: ASA_3999
Name: uvrA
Funciton: Excinuclease ABC subunit A
uvrA
Excinuclease ABC subunit A

Position: 11
Score: 5.2
Sequence: AACTGTTTATTCGTACAGTG
Locus tag: ASA_3190
Name: dinB
Funciton: DNA polymerase IV (EC 2.7.7.7)
dinB
DNA polymerase IV (EC 2.7.7.7)

Position: -26
Score: 5.4
Sequence: GCCTGTATAAATAAACAGGA
Locus tag: ASA_4174
Name: uvrD
Funciton: ATP-dependent DNA helicase II
uvrD
ATP-dependent DNA helicase II
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD