Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of LexA in Moritella sp. PE36

Properties
Regulator type: Transcription factor
TF locus tag: PE36_16374
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes 13
- Operons 12
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 77 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -50
Score: 5.2
Sequence: TACTGTATATAATTACAAGA
Position: -30
Score: 5.9
Sequence: AACTGTATATAAAACCAGTT
Locus tag: PE36_16374
Name: lexA
Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
lexA
SOS-response repressor and protease LexA (EC 3.4.21.88)

Position: -50
Score: 4.8
Sequence: AACTGGTCTTTTATACAGTG
Locus tag: PE36_21990
Name: dinB
Funciton: DNA polymerase IV (EC 2.7.7.7)
dinB
DNA polymerase IV (EC 2.7.7.7)

Position: -35
Score: 5.4
Sequence: ATATGTTTATATATACAGTA
Locus tag: PE36_16064
Name: recG
Funciton: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
recG
ATP-dependent DNA helicase RecG (EC 3.6.1.-)

Position: -65
Score: 5.4
Sequence: AACTGTATATACATCCAGAT
Locus tag: PE36_11322
Name: radA
Funciton: DNA repair protein RadA
radA
DNA repair protein RadA

Position: -68
Score: 5.5
Sequence: TACTGTATGAACGAACAGTA
Locus tag: PE36_23016
Name: recA
Funciton: Recombinase A
recA
Recombinase A

Position: -36
Score: 5.5
Sequence: AACTGTTTATTCATACAGTC
Locus tag: PE36_16620
Name: topB
Funciton: DNA topoisomerase III (EC 5.99.1.2)
topB
DNA topoisomerase III (EC 5.99.1.2)

Position: -74
Score: 5.3
Sequence: ATCTGGATATTTAACCAGTA
Locus tag: PE36_02589
Name: ruvA
Funciton: Holliday junction DNA helicase RuvA
Locus tag: PE36_02584
Name: ruvB
Funciton: Holliday junction DNA helicase RuvB
ruvA
Holliday junction DNA helicase RuvA
ruvB
Holliday junction DNA helicase RuvB

Position: -38
Score: 4.8
Sequence: CACTGTCATAATATACAGTG
Locus tag: PE36_11847
Name: yebG
Funciton: SOS regulon DNA damage-inducible protein
yebG
SOS regulon DNA damage-inducible protein

Position: -35
Score: 5.6
Sequence: TACTGATTAAATATACAGTC
Locus tag: PE36_15844
Name: uvrD
Funciton: ATP-dependent DNA helicase II
uvrD
ATP-dependent DNA helicase II

Position: -42
Score: 5.5
Sequence: TACTGTATATAAAACCAGGC
Position: -25
Score: 4.2
Sequence: GGCTGATAAAATAAACAGGA
Locus tag: PE36_05748
Name: recN
Funciton: DNA repair protein RecN
recN
DNA repair protein RecN

Position: -45
Score: 4.8
Sequence: TGCTGTACACTTAACCAGTC
Locus tag: PE36_19455
Name: polB
Funciton: DNA polymerase II (EC 2.7.7.7)
polB
DNA polymerase II (EC 2.7.7.7)

Position: -37
Score: 5.4
Sequence: TACTGTATGTATAACCACTG
Position: -22
Score: 4.7
Sequence: CACTGGATATGCAAACAGGC
Locus tag: PE36_14089
Name: SSF52540
Funciton: hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family
SSF52540
hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD