Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of LexA in Psychromonas ingrahamii 37

Properties
Regulator type: Transcription factor
TF locus tag: Ping_0108
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes 9
- Operons 8
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 77 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -64
Score: 5.3
Sequence: TACTGGATATTTACTCAGTT
Locus tag: Ping_0718
Name: ruvA
Funciton: Holliday junction DNA helicase RuvA
Locus tag: Ping_0719
Name: ruvB
Funciton: Holliday junction DNA helicase RuvB
ruvA
Holliday junction DNA helicase RuvA
ruvB
Holliday junction DNA helicase RuvB

Position: -58
Score: 4.6
Sequence: CCATGTATGAATATACACTG
Position: -43
Score: 4.9
Sequence: CACTGTTCATGTTTACAGTT
Locus tag: Ping_0108
Name: lexA
Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
lexA
SOS-response repressor and protease LexA (EC 3.4.21.88)

Position: -41
Score: 4.8
Sequence: TACTGTTGTTTTATACAGTG
Position: -26
Score: 4.5
Sequence: CAGTGTTTTTAAATACAGGT
Locus tag: Ping_2235
Name: SSF52540
Funciton: hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family
SSF52540
hypothetical protein, P-loop containing nucleoside triphosphate hydrolase family

Position: -34
Score: 5.8
Sequence: TACTGTGTAAAAAAACAGTT
Locus tag: Ping_2461
Name: topB
Funciton: DNA topoisomerase III (EC 5.99.1.2)
topB
DNA topoisomerase III (EC 5.99.1.2)

Position: -89
Score: 5.5
Sequence: TACTGTGTAAATCAACAGTA
Position: -55
Score: 5.2
Sequence: TACTGAGTGCATATACAGTT
Locus tag: Ping_3381
Name: recA
Funciton: Recombinase A
recA
Recombinase A

Position: -95
Score: 5.5
Sequence: TACTGTATAAAAATACATGA
Locus tag: Ping_2220
Name: yebG
Funciton: SOS regulon DNA damage-inducible protein
yebG
SOS regulon DNA damage-inducible protein

Position: -71
Score: 6.1
Sequence: TACTGTTTAAAAAAACAGTA
Position: -48
Score: 5.2
Sequence: GACTGTGCAAATAAACAGTG
Locus tag: Ping_0914
Name: recN
Funciton: DNA repair protein RecN
recN
DNA repair protein RecN

Position: -28
Score: 5.5
Sequence: TACTGAATAAATAAACAGGT
Locus tag: Ping_0008
Name: uvrD
Funciton: ATP-dependent DNA helicase II
uvrD
ATP-dependent DNA helicase II
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD