Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ModE in Xanthobacter autotrophicus Py2

Properties
Regulator type: Transcription factor
TF locus tag: Xaut_3199
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Regulog: ModE - Rhizobiales
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -38
Score: 4.2
Sequence: GCTGTATATGAACGAGCATACC
Locus tag: Xaut_3202
Name: modA
Funciton: Molybdate ABC transporter, substrate-binding protein
Locus tag: Xaut_3201
Name: modB
Funciton: Molybdate ABC transporter, permease protein
modA
Molybdate ABC transporter, substrate-binding protein
modB
Molybdate ABC transporter, permease protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD