Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ModE in Mesorhizobium loti MAFF303099

Properties
Regulator type: Transcription factor
TF locus tag: mll1462
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Regulog: ModE - Rhizobiales
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -71
Score: 5.9
Sequence: GTTATATTCATGCGGATATATC
Locus tag: mll1465
Name: modA
Funciton: Molybdate ABC transporter, substrate-binding protein
Locus tag: mll1464
Name: modB
Funciton: Molybdate ABC transporter, permease protein
Locus tag: mll1463
Name: modC
Funciton: Molybdate ABC transporter, ATP-binding protein
modA
Molybdate ABC transporter, substrate-binding protein
modB
Molybdate ABC transporter, permease protein
modC
Molybdate ABC transporter, ATP-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD