Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ModE in Delftia acidovorans SPH-1

Properties
Regulator type: Transcription factor
TF locus tag: Daci_1521
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Regulog: ModE - Comamonadaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -86
Score: 7
Sequence: CGCTATTCCGTTGGTGAATAGCG
Locus tag: Daci_1521
Name: modE
Funciton: Molybdate-responsive transcriptional regulator ModE
modE
Molybdate-responsive transcriptional regulator ModE

Position: 26
Score: 6.8
Sequence: CGCTATTCACCAACGGAATAGCG
Locus tag: Daci_1520
Name: modA
Funciton: Molybdate ABC transporter, substrate-binding protein
Locus tag: Daci_1519
Name: modB
Funciton: Molybdate ABC transporter, permease protein
Locus tag: Daci_1518
Name: modC
Funciton: Molybdate ABC transporter, ATP-binding protein
modA
Molybdate ABC transporter, substrate-binding protein
modB
Molybdate ABC transporter, permease protein
modC
Molybdate ABC transporter, ATP-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD