Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ModE in Hahella chejuensis KCTC 2396

Properties
Regulator type: Transcription factor
TF locus tag: HCH_02455
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Regulog: ModE - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -80
Score: 6.2
Sequence: AGCGTTATATAGAATACTATATAGCGCT
Locus tag: HCH_02455
Name: modE
Funciton: Molybdate-responsive transcriptional regulator ModE
Locus tag: HCH_02454
Name: modA
Funciton: Molybdate ABC transporter, substrate-binding protein
modE
Molybdate-responsive transcriptional regulator ModE
modA
Molybdate ABC transporter, substrate-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD