Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ModE in Moritella sp. PE36

Properties
Regulator type: Transcription factor
TF locus tag: PE36_17140
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Regulog: ModE - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -75
Score: 5.7
Sequence: ATCGATATATAGCTTACTATACAGCGCT
Locus tag: PE36_17160
Name: modA
Funciton: Molybdate ABC transporter, substrate-binding protein
Locus tag: PE36_17165
Name: modB
Funciton: Molybdate ABC transporter, permease protein
Locus tag: PE36_17170
Name: modC
Funciton: Molybdate ABC transporter, ATP-binding protein
modA
Molybdate ABC transporter, substrate-binding protein
modB
Molybdate ABC transporter, permease protein
modC
Molybdate ABC transporter, ATP-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD