Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RbsR in Pseudomonas entomophila L48

Properties
Regulator type: Transcription factor
TF locus tag: PSEEN1955
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR - Pseudomonadaceae
Statistics of regulated genes:
- Genes 7
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -52
Score: 6.6
Sequence: CACCGCAAACGTTTGCGATC
Locus tag: PSEEN1952
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: PSEEN1953
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: PSEEN1954
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: PSEEN1955
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: PSEEN1956
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: PSEEN1957
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: PSEEN1958
Name: uriH
Funciton: Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1)
rbsB
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsA
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsR
Transcriptional repressor of ribose utilization, LacI family
rbsK
Ribokinase (EC 2.7.1.15)
rbsD
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
uriH
Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD