Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RbsR in Actinobacillus pleuropneumoniae serovar 7 str. AP76

Properties
Regulator type: Transcription factor
TF locus tag: APP7_1728
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR - Pasteurellales
Statistics of regulated genes:
- Genes 5
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -48
Score: 6.1
Sequence: TCATCGAAACGTTTCGATAA
Locus tag: APP7_1729
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: APP7_1730
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: APP7_1731
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: APP7_1732
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: APP7_1733
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
rbsD
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsA
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsB
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsK
Ribokinase (EC 2.7.1.15)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD