Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of KdgR in Mannheimia succiniciproducens MBEL55E

Properties
Regulator type: Transcription factor
TF locus tag: MS0562
Regulator family: IclR
Regulation mode: repressor
Biological process: Pectin and polygalacturonate utlization
Effector: 2-keto-3-deoxygluconate
Regulog: KdgR - Pasteurellales
Statistics of regulated genes:
- Genes 13
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 17 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -124
Score: 4.8
Sequence: TAATAAAATAAAACATTATTT
Position: -119
Score: 6.1
Sequence: AAATAAAACATTATTTCAAAT
Locus tag: MS1742
Name: pelX
Funciton: Exopolygalacturonate lyase (EC 4.2.2.9)
pelX
Exopolygalacturonate lyase (EC 4.2.2.9)

Position: -155
Score: 6.1
Sequence: AATTAAAATAATGTTTTATTT
Locus tag: MS0698
Name: oglP
Funciton: predicted oligogalacturonate TRAP transporter, substrate-binding subunit
Locus tag: MS0697
Name: oglQ
Funciton: predicted oligogalacturonate TRAP transporter, small transmembrane subunit
Locus tag: MS0696
Name: oglM
Funciton: predicted oligogalacturonate TRAP transporter, large transmembrane subunit
oglP
predicted oligogalacturonate TRAP transporter, substrate-binding subunit
oglQ
predicted oligogalacturonate TRAP transporter, small transmembrane subunit
oglM
predicted oligogalacturonate TRAP transporter, large transmembrane subunit

Position: -99
Score: 6.1
Sequence: AAATAAAACAATGTTTTAAAT
Locus tag: MS1741
Name: togX
Funciton: predicted oligogalacturonate transporter
Locus tag: MS1740
Name: ogl
Funciton: Oligogalacturonate lyase (EC 4.2.2.6)
togX
predicted oligogalacturonate transporter
ogl
Oligogalacturonate lyase (EC 4.2.2.6)

Position: -208
Score: 5.1
Sequence: ATTAAAAATAAAATTTTAGAA
Position: -170
Score: 5.9
Sequence: TTTTAAAATATTGTTTTATTT
Position: -107
Score: 5.3
Sequence: ATTTGACATAGTGTTTCAATT
Locus tag: MS0561
Name: oglO
Funciton: predicted oligogalacturonate-specific outer membrane porin
oglO
predicted oligogalacturonate-specific outer membrane porin

Position: -126
Score: 5.9
Sequence: ATATAAAACATAATTTCATTT
Locus tag: MS0562
Name: kdgR
Funciton: 2-keto-3-deoxygluconate regulator, IclR family
kdgR
2-keto-3-deoxygluconate regulator, IclR family

Position: -88
Score: 5.9
Sequence: AAATGAAATTATGTTTTATAT
Locus tag: MS0563
Name: kduD
Funciton: 2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125)
Locus tag: MS0564
Name: spiX
Funciton: predicted 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
Locus tag: MS0565
Name: kdgK
Funciton: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
Locus tag: MS0566
Name: eda
Funciton: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
Locus tag: MS0567
Name: kdgF
Funciton: Pectin degradation protein
kduD
2-deoxy-D-gluconate 3-dehydrogenase (EC 1.1.1.125)
spiX
predicted 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
kdgK
2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
eda
2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
kdgF
Pectin degradation protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD