Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of TrpR in Xylella fastidiosa 9a5c

Properties
Regulator type: Transcription factor
TF locus tag: XF1920
Regulator family: TrpR
Regulation mode: repressor
Biological process: Tryptophan biosynthesis
Effector: Tryptophan
Regulog: TrpR - Xanthomonadales
Statistics of regulated genes:
- Genes 4
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 1 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -52
Score: 5.9
Sequence: CGTACTGATGTACCATTACA
Locus tag: XF1914
Name: trpE
Funciton: Anthranilate synthase, aminase component (EC 4.1.3.27)
Locus tag: XF1915
Name: trpG
Funciton: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) @ Para-aminobenzoate synthase, amidotransferase component (EC 2.6.1.85)
Locus tag: XF1916
Name: COG1541
Funciton: Coenzyme F390 synthetase
Locus tag: XF1917
Name: SSF55729
Funciton: Acyl-CoA N-acyltransferase
trpE
Anthranilate synthase, aminase component (EC 4.1.3.27)
trpG
Anthranilate synthase, amidotransferase component (EC 4.1.3.27) @ Para-aminobenzoate synthase, amidotransferase component (EC 2.6.1.85)
COG1541
Coenzyme F390 synthetase
SSF55729
Acyl-CoA N-acyltransferase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD