Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of TrpR in Psychrobacter sp. PRwf-1

Properties
Regulator type: Transcription factor
TF locus tag: PsycPRwf_1155
Regulator family: TrpR
Regulation mode: repressor
Biological process: Tryptophan biosynthesis
Effector: Tryptophan
Regulog: TrpR - Moraxellaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -130
Score: 4.8
Sequence: CGTATCAGTGTACTAGAACA
Locus tag: PsycPRwf_1460
Name: trpB
Funciton: Tryptophan synthase beta chain like (EC 4.2.1.20)
trpB
Tryptophan synthase beta chain like (EC 4.2.1.20)

Position: -48
Score: 5
Sequence: TGTACTACTGTACTAGAATA
Locus tag: PsycPRwf_1155
Name: trpR
Funciton: Trp operon repressor
Locus tag: PsycPRwf_1154
Name: trpE
Funciton: Anthranilate synthase, aminase component (EC 4.1.3.27)
Locus tag: PsycPRwf_1153
Name: trpG
Funciton: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
trpR
Trp operon repressor
trpE
Anthranilate synthase, aminase component (EC 4.1.3.27)
trpG
Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD