Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Fur in Stenotrophomonas maltophilia K279a

Properties
Regulator type: Transcription factor
TF locus tag: Smlt1986
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Regulog: Fur - Xanthomonadales
Statistics of regulated genes:
- Genes 39
- Operons 17
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 49 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -136
Score: 4.5
Sequence: TGTTAAGAATTATTTACATTT
Locus tag: Smlt1233
Name: fpvA
Funciton: Putative receptor for Fe(III)-coprogen, Fe(III)-ferrioxamine B and Fe(III)-rhodotrulic acid, TonB-dependent
fpvA
Putative receptor for Fe(III)-coprogen, Fe(III)-ferrioxamine B and Fe(III)-rhodotrulic acid, TonB-dependent

Position: -87
Score: 4.6
Sequence: GGATGCAAATGATTCTCTTTT
Locus tag: Smlt2935
Name: fecI4
Funciton: putative ECF-family sigma factor for iron metabolism
Locus tag: Smlt2936
Name: fecR4
Funciton: putative transcriptional regulatory FecR iron transport regulator family protein
Locus tag: Smlt2937
Name: fecA4
Funciton: putative TonB dependent receptor protein
Locus tag: Smlt2938
Name: null
Funciton: putative iron regulated lipoprotein
Locus tag: Smlt2939
Name: null
Funciton: putative TonB-like protein
fecI4
putative ECF-family sigma factor for iron metabolism
fecR4
putative transcriptional regulatory FecR iron transport regulator family protein
fecA4
putative TonB dependent receptor protein
putative iron regulated lipoprotein
putative TonB-like protein

Position: -28
Score: 5.8
Sequence: TAATGGGAATCATTCGCATTA
Locus tag: Smlt2848
Name: fecI
Funciton: Putative RNA polymerase sigma factor for iron metabolism
Locus tag: Smlt2849
Name: fecR
Funciton: Putative transmembrane FecR family iron uptake regulator protein
Locus tag: Smlt2850
Name: fecA
Funciton: putative TonB dependent extracellular heme-binding protein
fecI
Putative RNA polymerase sigma factor for iron metabolism
fecR
Putative transmembrane FecR family iron uptake regulator protein
fecA
putative TonB dependent extracellular heme-binding protein

Position: -61
Score: 5.5
Sequence: CAATGAGAACCCATCTCATTT
Locus tag: Smlt3227
Name: fpr
Funciton: Ferredoxin--NADP(+) reductase (EC 1.18.1.2)
fpr
Ferredoxin--NADP(+) reductase (EC 1.18.1.2)

Position: -38
Score: 4.5
Sequence: AATCGAGAACCATTTACATCC
Locus tag: Smlt2210
Name: feoA
Funciton: Ferrous iron transport protein A
Locus tag: Smlt2211
Name: feoB
Funciton: Ferrous iron transport protein B
Locus tag: Smlt2212
Name: XF0934
Funciton: conserved hypothetical protein
feoA
Ferrous iron transport protein A
feoB
Ferrous iron transport protein B
XF0934
conserved hypothetical protein

Position: -94
Score: 4.8
Sequence: AAATAGGAATAGTTCGTATTA
Locus tag: Smlt3999
Name: fhuE
Funciton: Putative TonB-dependent receptor for Fe(III)-coprogen, Fe(III)-ferrioxamine B and Fe(III)-rhodotrulic acid, TonB-dependent
fhuE
Putative TonB-dependent receptor for Fe(III)-coprogen, Fe(III)-ferrioxamine B and Fe(III)-rhodotrulic acid, TonB-dependent

Position: -99
Score: 5.3
Sequence: TTTTGGCAATCATTCTCATTT
Position: -76
Score: 4.1
Sequence: AACGGCTAACAGCTCTCATTA
Locus tag: Smlt1145
Name: null
Funciton: putative transmembrane protein
Locus tag: Smlt1144c
Name: bfrA
Funciton: putative exogenous ferric siderophore receptor, TonB-dependent
putative transmembrane protein
bfrA
putative exogenous ferric siderophore receptor, TonB-dependent

Position: -86
Score: 5.4
Sequence: AAACGCGAACGGTTCCCATTA
Locus tag: Smlt2664
Name: fecI2
Funciton: putative RNA polymerase sigma factor for iron metabolism
Locus tag: Smlt2665
Name: fecR2
Funciton: putative iron uptake transcriptional regulator protein
Locus tag: Smlt2666
Name: fecA2
Funciton: putative TonB-dependent ferric siderophore receptor
fecI2
putative RNA polymerase sigma factor for iron metabolism
fecR2
putative iron uptake transcriptional regulator protein
fecA2
putative TonB-dependent ferric siderophore receptor

Position: -69
Score: 5.1
Sequence: AATTGAGAATGGTTGTTGATT
Position: -45
Score: 6.1
Sequence: AACTGAGAATCATTATCATTT
Locus tag: Smlt0794
Name: hemP
Funciton: Hemin uptake protein HemP
Locus tag: Smlt0795
Name: hemR
Funciton: Hemin uptake system outer membrane receptor, TonB-dependent
Locus tag: Smlt0796
Name: XAC0824
Funciton: Hemin transport protein
hemP
Hemin uptake protein HemP
hemR
Hemin uptake system outer membrane receptor, TonB-dependent
XAC0824
Hemin transport protein

Position: -81
Score: 4.2
Sequence: CAATGCGCACGATTCGCGTTC
Position: -73
Score: 5.4
Sequence: GATTGACAACCATTCTCGTTT
Locus tag: Smlt4298
Name: bfd
Funciton: Bacterioferritin-associated ferredoxin
Locus tag: Smlt4297
Name: bfr
Funciton: Bacterioferritin
bfd
Bacterioferritin-associated ferredoxin
bfr
Bacterioferritin

Position: -85
Score: 4.6
Sequence: AATTGCGAGCTATTCTCATCA
Locus tag: Smlt1142
Name: pepSY
Funciton: putative transmembrane PepSY family protein
Locus tag: Smlt1141
Name: COG3656
Funciton: Predicted periplasmic protein
pepSY
putative transmembrane PepSY family protein
COG3656
Predicted periplasmic protein

Position: -66
Score: 5.1
Sequence: ATATGCGAATCATTATCGTTG
Locus tag: Smlt1149
Name: null
Funciton: hypothetical protein
Locus tag: Smlt1148
Name: fhuA
Funciton: Ferrichrome-iron receptor, TonB-dependent
Locus tag: Smlt1147
Name: XAC2943
Funciton: FOG: TPR repeat, SEL1 subfamily
Locus tag: Smlt1146
Name: piuC
Funciton: Iron-uptake factor PiuC
hypothetical protein
fhuA
Ferrichrome-iron receptor, TonB-dependent
XAC2943
FOG: TPR repeat, SEL1 subfamily
piuC
Iron-uptake factor PiuC

Position: -69
Score: 5.1
Sequence: GAACGTGACTGATTCTCATTA
Locus tag: Smlt3900
Name: fecI3
Funciton: putative RNA polymerase ECF sigma factor for iron metabolism
Locus tag: Smlt3899
Name: fecR3
Funciton: putative transmembrane FecR sensor protein
Locus tag: Smlt3898
Name: fecA3
Funciton: putative extracellular heme-binding protein, TonB-dependent
fecI3
putative RNA polymerase ECF sigma factor for iron metabolism
fecR3
putative transmembrane FecR sensor protein
fecA3
putative extracellular heme-binding protein, TonB-dependent

Position: 4
Score: 5
Sequence: AATCAGCAATAATTCTCATTT
Locus tag: Smlt2858
Name: COG4771
Funciton: Outer membrane receptor for ferrienterochelin, TonB-dependent
COG4771
Outer membrane receptor for ferrienterochelin, TonB-dependent

Position: -126
Score: 5.6
Sequence: AAATGCGAATGCCTATCATTT
Locus tag: Smlt1567
Name: XAC0271
Funciton: Putative iron uptake protein
Locus tag: Smlt1566
Name: pepSY
Funciton: putative transmembrane PepSY domain protein
Locus tag: Smlt1565
Name: XAC0269
Funciton: Putative iron uptake protein
XAC0271
Putative iron uptake protein
pepSY
putative transmembrane PepSY domain protein
XAC0269
Putative iron uptake protein

Position: -42
Score: 5.9
Sequence: AAATGCTAATCTTTCTCATTT
Locus tag: Smlt3022
Name: fhuA
Funciton: Outer membrane receptor proteins, mostly Fe transport, TonB-dependent
fhuA
Outer membrane receptor proteins, mostly Fe transport, TonB-dependent

Position: -142
Score: 4.8
Sequence: ATTTGAGAATCACTCGCATTG
Locus tag: Smlt1426
Name: pfeA
Funciton: Outer membrane receptor for ferrienterochelin, TonB-dependent
pfeA
Outer membrane receptor for ferrienterochelin, TonB-dependent
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD