Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Fur in Xanthomonas campestris pv. campestris str. ATCC 33913

Properties
Regulator type: Transcription factor
TF locus tag: XCC1470
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Regulog: Fur - Xanthomonadales
Statistics of regulated genes:
- Genes 20
- Operons 11
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 49 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -167
Score: 5.6
Sequence: AAACGATAACGATTTACATTT
Locus tag: XCC0158
Name: fpvA
Funciton: Putative receptor for Fe(III)-coprogen, Fe(III)-ferrioxamine B and Fe(III)-rhodotrulic acid, TonB-dependent
fpvA
Putative receptor for Fe(III)-coprogen, Fe(III)-ferrioxamine B and Fe(III)-rhodotrulic acid, TonB-dependent

Position: -31
Score: 4.6
Sequence: GGATAAGAATCGTTATCATTG
Locus tag: XCC4162
Name: COG4773
Funciton: Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent
COG4773
Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent

Position: -35
Score: 4.6
Sequence: AATTGAGAACCATTCCTAACA
Locus tag: XCC1834
Name: feoA
Funciton: Ferrous iron transport protein A
Locus tag: XCC1835
Name: feoB
Funciton: Ferrous iron transport protein B
Locus tag: XCC1836
Name: XF0934
Funciton: conserved hypothetical protein
feoA
Ferrous iron transport protein A
feoB
Ferrous iron transport protein B
XF0934
conserved hypothetical protein

Position: -73
Score: 5.5
Sequence: AAATGAGAGTTCATCTCATTT
Locus tag: XCC1414
Name: fpr
Funciton: Ferredoxin--NADP(+) reductase (EC 1.18.1.2)
fpr
Ferredoxin--NADP(+) reductase (EC 1.18.1.2)

Position: -26
Score: 4.9
Sequence: AAATGAGAATGGCTCTTGATC
Position: -2
Score: 6.1
Sequence: AAATGAGAATGGTTATTATTT
Locus tag: XCC0767
Name: hemP
Funciton: Hemin uptake protein HemP
Locus tag: XCC0768
Name: hemR
Funciton: Hemin uptake system outer membrane receptor, TonB-dependent
Locus tag: XCC0769
Name: XAC0824
Funciton: Hemin transport protein
hemP
Hemin uptake protein HemP
hemR
Hemin uptake system outer membrane receptor, TonB-dependent
XAC0824
Hemin transport protein

Position: -73
Score: 5
Sequence: AATTGACACCTATTCTCGTTT
Locus tag: XCC0481
Name: bfd
Funciton: Bacterioferritin-associated ferredoxin
bfd
Bacterioferritin-associated ferredoxin

Position: -72
Score: 5.2
Sequence: TAATAATATTCATTCTCACTT
Locus tag: XCC3518
Name: fpvA
Funciton: Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent
fpvA
Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent

Position: -263
Score: 5.5
Sequence: AAAGAAGAATGATTTGCATTT
Locus tag: XCC2772
Name: fhuA
Funciton: Ferrichrome-iron receptor, TonB-dependent
Locus tag: XCC2773
Name: piuC
Funciton: Iron-uptake factor PiuC
Locus tag: XCC2774
Name: XAC2943
Funciton: FOG: TPR repeat, SEL1 subfamily
Locus tag: XCC2775
Name: pepSY
Funciton: putative transmembrane PepSY family protein
Locus tag: XCC2776
Name: COG3656
Funciton: Predicted periplasmic protein
fhuA
Ferrichrome-iron receptor, TonB-dependent
piuC
Iron-uptake factor PiuC
XAC2943
FOG: TPR repeat, SEL1 subfamily
pepSY
putative transmembrane PepSY family protein
COG3656
Predicted periplasmic protein

Position: -28
Score: 5.2
Sequence: ATTTGATAACCATTCCCATTA
Locus tag: XCC1391
Name: fhuA
Funciton: Outer membrane receptor proteins, mostly Fe transport, TonB-dependent
fhuA
Outer membrane receptor proteins, mostly Fe transport, TonB-dependent

Position: -80
Score: 4.4
Sequence: AACTGATCACGATTCGCGTTC
Locus tag: XCC0482
Name: bfr
Funciton: Bacterioferritin
bfr
Bacterioferritin

Position: -121
Score: 6
Sequence: AAATGTGAATCATTCCCATTA
Locus tag: XCC3216
Name: fhuE
Funciton: Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent
Locus tag: XCC3215
Name: fhuE
Funciton: Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent
fhuE
Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent
fhuE
Outer membrane receptor for ferric coprogen and ferric-rhodotorulic acid, TonB-dependent
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD