Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Fur in Xylella fastidiosa 9a5c

Properties
Regulator type: Transcription factor
TF locus tag: XF2344
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Regulog: Fur - Xanthomonadales
Statistics of regulated genes:
- Genes 10
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 49 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -34
Score: 4.7
Sequence: TATTGAGAACGATTCTTGTCA
Locus tag: XF0932
Name: feoA
Funciton: Ferrous iron transport protein A
Locus tag: XF0933
Name: feoB
Funciton: Ferrous iron transport protein B
Locus tag: XF0934
Name: XF0934
Funciton: conserved hypothetical protein
feoA
Ferrous iron transport protein A
feoB
Ferrous iron transport protein B
XF0934
conserved hypothetical protein

Position: -37
Score: 5.1
Sequence: AAATGCGAATTATTCGCGGTT
Locus tag: XF0175
Name: COG1272
Funciton: Predicted membrane protein hemolysin III homolog
COG1272
Predicted membrane protein hemolysin III homolog

Position: -78
Score: 4.9
Sequence: TAATGAGCACGATTTTCGTTC
Locus tag: XF0395
Name: bfr
Funciton: Bacterioferritin
bfr
Bacterioferritin

Position: -64
Score: 5.4
Sequence: AATTGACATTCATTCTCATCT
Locus tag: XF0394
Name: bfd
Funciton: Bacterioferritin-associated ferredoxin
bfd
Bacterioferritin-associated ferredoxin

Position: -112
Score: 5.6
Sequence: TATTGAAAATCATTCTCCTTT
Locus tag: XF0599
Name: fhuA
Funciton: Ferrichrome-iron receptor, TonB-dependent
Locus tag: XF0598
Name: piuC
Funciton: Iron-uptake factor PiuC
Locus tag: XF0597
Name: pepSY
Funciton: putative transmembrane PepSY family protein
Locus tag: XF0596
Name: COG3656
Funciton: Predicted periplasmic protein
fhuA
Ferrichrome-iron receptor, TonB-dependent
piuC
Iron-uptake factor PiuC
pepSY
putative transmembrane PepSY family protein
COG3656
Predicted periplasmic protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD