Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NrtR2 in Cyanothece sp. PCC 7425

Properties
Regulator type: Transcription factor
TF locus tag: Cyan7425_2119
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR2 - Cyanobacteria
Statistics of regulated genes:
- Genes 5
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -49
Score: 5.1
Sequence: ATAGTGTTATTGAGACACTAT
Position: -26
Score: 5.9
Sequence: TTAGTGTAGTTTATACACAAA
Locus tag: Cyan7425_2213
Name: null
Funciton: hypothetical protein
Locus tag: Cyan7425_2212
Name: draG
Funciton: ADP-ribosylglycohydrolase superfamkily
Locus tag: Cyan7425_2211
Name: null
Funciton: hypothetical protein
Locus tag: Cyan7425_2210
Name: pncA
Funciton: Nicotinamidase (EC 3.5.1.19)
Locus tag: Cyan7425_2209
Name: null
Funciton: hypothetical protein
hypothetical protein
draG
ADP-ribosylglycohydrolase superfamkily
hypothetical protein
pncA
Nicotinamidase (EC 3.5.1.19)
hypothetical protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD