Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of IscR in Geobacter sulfurreducens PCA

Properties
Regulator type: Transcription factor
TF locus tag: GSU2571
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Desulfuromonadales
Statistics of regulated genes:
- Genes 5
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -59
Score: 6.4
Sequence: ATACCTGACAATTTTGCTATAGTAT
Locus tag: GSU2012
Name: iscU
Funciton: Iron-sulfur cluster assembly scaffold protein IscU
Locus tag: GSU2011
Name: iscS
Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU
Iron-sulfur cluster assembly scaffold protein IscU
iscS
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily

Position: -130
Score: 6.5
Sequence: GAAGTTGACAAAAATTGTAGGGTAT
Locus tag: GSU2572
Name: cysE
Funciton: Serine acetyltransferase (EC 2.3.1.30)
Locus tag: GSU2571
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: GSU2570
Name: iscS
Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
cysE
Serine acetyltransferase (EC 2.3.1.30)
iscR
Iron-sulfur cluster regulator IscR
iscS
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD