Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of IscR in Caulobacter segnis ATCC 21756

Properties
Regulator type: Transcription factor
TF locus tag: Cseg_2153
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Caulobacterales
Statistics of regulated genes:
- Genes 8
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -127
Score: 8.4
Sequence: ATACTTGACCGCCGCGCTTGGTCTT
Locus tag: Cseg_2153
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: Cseg_2152
Name: iscS
Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Locus tag: Cseg_2151
Name: sufB
Funciton: Iron-sulfur cluster assembly protein SufB
Locus tag: Cseg_2150
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: Cseg_2149
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: Cseg_2148
Name: sufS
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Locus tag: Cseg_2147
Name: sufT
Funciton: Iron sulfur cluster assembly protein SufT
Locus tag: Cseg_2146
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
iscR
Iron-sulfur cluster regulator IscR
iscS
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
sufB
Iron-sulfur cluster assembly protein SufB
sufC
Iron-sulfur cluster assembly ATPase protein SufC
sufD
Iron-sulfur cluster assembly protein SufD
sufS
Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
sufT
Iron sulfur cluster assembly protein SufT
sufA
Iron binding protein SufA for iron-sulfur cluster assembly
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD