Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of IscR in Caulobacter crescentus CB15

Properties
Regulator type: Transcription factor
TF locus tag: CC1866
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Caulobacterales
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -128
Score: 8.4
Sequence: ATACTTGACCGCCGCGCTTGGTCTT
Locus tag: CC1866
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
iscR
Iron-sulfur cluster regulator IscR
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD