Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of IscR in Variovorax paradoxus S110

Properties
Regulator type: Transcription factor
TF locus tag: Vapar_2141
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Comamonadaceae
Statistics of regulated genes:
- Genes 7
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -165
Score: 5.9
Sequence: ATACTTGAGCGAAATACTCAACAAC
Position: -152
Score: 5.4
Sequence: ATACTCAACAACAACAAAAAAGAAC
Locus tag: Vapar_2141
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: Vapar_2142
Name: iscS
Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Locus tag: Vapar_2143
Name: iscU
Funciton: Iron-sulfur cluster assembly scaffold protein IscU
Locus tag: Vapar_2144
Name: iscA
Funciton: Iron binding protein IscA for iron-sulfur cluster assembly
Locus tag: Vapar_2145
Name: hscB
Funciton: Chaperone protein HscB
Locus tag: Vapar_2146
Name: hscA
Funciton: Chaperone protein HscA
Locus tag: Vapar_2147
Name: fdx
Funciton: ferredoxin, 2Fe-2S type, ISC system
iscR
Iron-sulfur cluster regulator IscR
iscS
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU
Iron-sulfur cluster assembly scaffold protein IscU
iscA
Iron binding protein IscA for iron-sulfur cluster assembly
hscB
Chaperone protein HscB
hscA
Chaperone protein HscA
fdx
ferredoxin, 2Fe-2S type, ISC system
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD