Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of IscR in Xanthomonas campestris pv. campestris str. ATCC 33913

Properties
Regulator type: Transcription factor
TF locus tag: XCC2765
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Xanthomonadales
Statistics of regulated genes:
- Genes 5
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -44
Score: 8.4
Sequence: AAAGAGTACAATTTCGGTCCGCTTT
Locus tag: XCC2765
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: XCC2766
Name: sufB
Funciton: Iron-sulfur cluster assembly protein SufB
Locus tag: XCC2767
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: XCC2768
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: XCC2769
Name: sufS
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
iscR
Iron-sulfur cluster regulator IscR
sufB
Iron-sulfur cluster assembly protein SufB
sufC
Iron-sulfur cluster assembly ATPase protein SufC
sufD
Iron-sulfur cluster assembly protein SufD
sufS
Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD