Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of IscR in Chromohalobacter salexigens DSM 3043

Properties
Regulator type: Transcription factor
TF locus tag: Csal_2847
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 41 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -76
Score: 5.5
Sequence: AAAGTTGACCGTTTTGCTTGGTCTT
Locus tag: Csal_3299
Name: erpA
Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
erpA
ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family

Position: -71
Score: 5
Sequence: ATGGTTGACCGCGTTACTGGGTTTT
Locus tag: Csal_2847
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: Csal_2848
Name: iscS
Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Locus tag: Csal_2849
Name: iscA
Funciton: Iron binding protein IscA for iron-sulfur cluster assembly
iscR
Iron-sulfur cluster regulator IscR
iscS
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscA
Iron binding protein IscA for iron-sulfur cluster assembly
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD